ID: 1176285479

View in Genome Browser
Species Human (GRCh38)
Location 21:5016863-5016885
Sequence GGTGGCCCCGGAGATGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176285479_1176285492 30 Left 1176285479 21:5016863-5016885 CCAGCCCCATCTCCGGGGCCACC No data
Right 1176285492 21:5016916-5016938 CCTCCCCTCCTCTCAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176285479 Original CRISPR GGTGGCCCCGGAGATGGGGC TGG (reversed) Intergenic
No off target data available for this crispr