ID: 1176285481

View in Genome Browser
Species Human (GRCh38)
Location 21:5016868-5016890
Sequence CACTGGGTGGCCCCGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176285481_1176285492 25 Left 1176285481 21:5016868-5016890 CCCATCTCCGGGGCCACCCAGTG No data
Right 1176285492 21:5016916-5016938 CCTCCCCTCCTCTCAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176285481 Original CRISPR CACTGGGTGGCCCCGGAGAT GGG (reversed) Intergenic
No off target data available for this crispr