ID: 1176285482

View in Genome Browser
Species Human (GRCh38)
Location 21:5016869-5016891
Sequence CCACTGGGTGGCCCCGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176285482_1176285492 24 Left 1176285482 21:5016869-5016891 CCATCTCCGGGGCCACCCAGTGG No data
Right 1176285492 21:5016916-5016938 CCTCCCCTCCTCTCAGCAGCAGG No data
1176285482_1176285496 30 Left 1176285482 21:5016869-5016891 CCATCTCCGGGGCCACCCAGTGG No data
Right 1176285496 21:5016922-5016944 CTCCTCTCAGCAGCAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176285482 Original CRISPR CCACTGGGTGGCCCCGGAGA TGG (reversed) Intergenic
No off target data available for this crispr