ID: 1176285485

View in Genome Browser
Species Human (GRCh38)
Location 21:5016875-5016897
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176285485_1176285497 25 Left 1176285485 21:5016875-5016897 CCGGGGCCACCCAGTGGGCGCTG No data
Right 1176285497 21:5016923-5016945 TCCTCTCAGCAGCAGGCACTGGG No data
1176285485_1176285496 24 Left 1176285485 21:5016875-5016897 CCGGGGCCACCCAGTGGGCGCTG No data
Right 1176285496 21:5016922-5016944 CTCCTCTCAGCAGCAGGCACTGG No data
1176285485_1176285492 18 Left 1176285485 21:5016875-5016897 CCGGGGCCACCCAGTGGGCGCTG No data
Right 1176285492 21:5016916-5016938 CCTCCCCTCCTCTCAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176285485 Original CRISPR CAGCGCCCACTGGGTGGCCC CGG (reversed) Intergenic
No off target data available for this crispr