ID: 1176285487

View in Genome Browser
Species Human (GRCh38)
Location 21:5016884-5016906
Sequence GAGCAAGCGCAGCGCCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176285487_1176285492 9 Left 1176285487 21:5016884-5016906 CCCAGTGGGCGCTGCGCTTGCTC No data
Right 1176285492 21:5016916-5016938 CCTCCCCTCCTCTCAGCAGCAGG No data
1176285487_1176285499 22 Left 1176285487 21:5016884-5016906 CCCAGTGGGCGCTGCGCTTGCTC No data
Right 1176285499 21:5016929-5016951 CAGCAGCAGGCACTGGGCTCTGG No data
1176285487_1176285496 15 Left 1176285487 21:5016884-5016906 CCCAGTGGGCGCTGCGCTTGCTC No data
Right 1176285496 21:5016922-5016944 CTCCTCTCAGCAGCAGGCACTGG No data
1176285487_1176285500 28 Left 1176285487 21:5016884-5016906 CCCAGTGGGCGCTGCGCTTGCTC No data
Right 1176285500 21:5016935-5016957 CAGGCACTGGGCTCTGGTTTCGG No data
1176285487_1176285497 16 Left 1176285487 21:5016884-5016906 CCCAGTGGGCGCTGCGCTTGCTC No data
Right 1176285497 21:5016923-5016945 TCCTCTCAGCAGCAGGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176285487 Original CRISPR GAGCAAGCGCAGCGCCCACT GGG (reversed) Intergenic
No off target data available for this crispr