ID: 1176285497

View in Genome Browser
Species Human (GRCh38)
Location 21:5016923-5016945
Sequence TCCTCTCAGCAGCAGGCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176285487_1176285497 16 Left 1176285487 21:5016884-5016906 CCCAGTGGGCGCTGCGCTTGCTC No data
Right 1176285497 21:5016923-5016945 TCCTCTCAGCAGCAGGCACTGGG No data
1176285488_1176285497 15 Left 1176285488 21:5016885-5016907 CCAGTGGGCGCTGCGCTTGCTCA No data
Right 1176285497 21:5016923-5016945 TCCTCTCAGCAGCAGGCACTGGG No data
1176285486_1176285497 19 Left 1176285486 21:5016881-5016903 CCACCCAGTGGGCGCTGCGCTTG No data
Right 1176285497 21:5016923-5016945 TCCTCTCAGCAGCAGGCACTGGG No data
1176285485_1176285497 25 Left 1176285485 21:5016875-5016897 CCGGGGCCACCCAGTGGGCGCTG No data
Right 1176285497 21:5016923-5016945 TCCTCTCAGCAGCAGGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176285497 Original CRISPR TCCTCTCAGCAGCAGGCACT GGG Intergenic
No off target data available for this crispr