ID: 1176285820

View in Genome Browser
Species Human (GRCh38)
Location 21:5018967-5018989
Sequence CGGGATTAAATTGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176285815_1176285820 7 Left 1176285815 21:5018937-5018959 CCTCATGTGGCAAAGGAAGGACT No data
Right 1176285820 21:5018967-5018989 CGGGATTAAATTGAGGTGGAAGG No data
1176285811_1176285820 20 Left 1176285811 21:5018924-5018946 CCTGTGAATGTTACCTCATGTGG No data
Right 1176285820 21:5018967-5018989 CGGGATTAAATTGAGGTGGAAGG No data
1176285809_1176285820 27 Left 1176285809 21:5018917-5018939 CCCGGATCCTGTGAATGTTACCT No data
Right 1176285820 21:5018967-5018989 CGGGATTAAATTGAGGTGGAAGG No data
1176285810_1176285820 26 Left 1176285810 21:5018918-5018940 CCGGATCCTGTGAATGTTACCTC No data
Right 1176285820 21:5018967-5018989 CGGGATTAAATTGAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176285820 Original CRISPR CGGGATTAAATTGAGGTGGA AGG Intergenic
No off target data available for this crispr