ID: 1176287914

View in Genome Browser
Species Human (GRCh38)
Location 21:5028596-5028618
Sequence TCAGGGGACACACGCCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176287914_1176287919 2 Left 1176287914 21:5028596-5028618 CCTCTTGGGCGTGTGTCCCCTGA 0: 2
1: 0
2: 0
3: 9
4: 82
Right 1176287919 21:5028621-5028643 AGACTGAAGCCCCCAGACACGGG 0: 2
1: 0
2: 0
3: 24
4: 243
1176287914_1176287924 19 Left 1176287914 21:5028596-5028618 CCTCTTGGGCGTGTGTCCCCTGA 0: 2
1: 0
2: 0
3: 9
4: 82
Right 1176287924 21:5028638-5028660 CACGGGAATCCCACTGCGCACGG 0: 2
1: 0
2: 0
3: 4
4: 57
1176287914_1176287918 1 Left 1176287914 21:5028596-5028618 CCTCTTGGGCGTGTGTCCCCTGA 0: 2
1: 0
2: 0
3: 9
4: 82
Right 1176287918 21:5028620-5028642 AAGACTGAAGCCCCCAGACACGG 0: 2
1: 0
2: 1
3: 29
4: 206
1176287914_1176287925 26 Left 1176287914 21:5028596-5028618 CCTCTTGGGCGTGTGTCCCCTGA 0: 2
1: 0
2: 0
3: 9
4: 82
Right 1176287925 21:5028645-5028667 ATCCCACTGCGCACGGCTGCTGG 0: 2
1: 0
2: 0
3: 8
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176287914 Original CRISPR TCAGGGGACACACGCCCAAG AGG (reversed) Intronic
900212715 1:1464258-1464280 TGTGGGCACACACGCCCCAGTGG - Intronic
900220236 1:1504708-1504730 TGTGGGCACACACGCCCCAGTGG - Intergenic
903832907 1:26185149-26185171 TCAAGGGACACACGCTCTACTGG + Exonic
904614898 1:31744310-31744332 TCAGGGAACACACGCTCCACGGG + Exonic
905296902 1:36960139-36960161 ACAGGGCACACAGGCTCAAGGGG - Intronic
906530489 1:46520971-46520993 GCATGGGTCACACGCCCATGAGG - Intergenic
907385392 1:54122343-54122365 GCAGGGGACACACGGACACGCGG + Intergenic
910725661 1:90336147-90336169 TCAGGGGACACCTGTCCATGAGG + Intergenic
916830754 1:168488490-168488512 CCAGGCAACACACCCCCAAGAGG - Intergenic
918511289 1:185316812-185316834 TCAGGGGAGGCAGCCCCAAGCGG - Intronic
921741720 1:218692888-218692910 TCAGGAAACACACACACAAGAGG + Intergenic
922339018 1:224640797-224640819 TCAGGGGTGACACACACAAGGGG - Intronic
1062763933 10:47420-47442 TCAGGGGTCGCATGCCCATGAGG - Exonic
1062909746 10:1205031-1205053 TCAGGGGACCCAGTCCCAGGTGG - Intronic
1062978685 10:1703911-1703933 ACAGGGGACTCACTCCTAAGAGG + Intronic
1068474975 10:57513350-57513372 TCAGGGGCCACATGTCCATGAGG + Intergenic
1071967148 10:90863412-90863434 TCAGGGGAAAATCTCCCAAGAGG + Intergenic
1073761063 10:106629358-106629380 TCAGCGGACACTCATCCAAGTGG - Exonic
1076430514 10:130398745-130398767 TTAGTGGTCACACGCACAAGCGG - Intergenic
1076763754 10:132619354-132619376 TCAGGGCACACAGGCTCAAGGGG + Intronic
1077519780 11:3025696-3025718 TCTGGGGACACATCCACAAGAGG - Intronic
1083934286 11:65862293-65862315 TCAGGGAGGACAGGCCCAAGTGG + Intronic
1085117824 11:73945798-73945820 TCAGAGGACACAGGCACAGGCGG + Intergenic
1085387340 11:76164674-76164696 AGAGGGGACACACGCACAGGGGG + Intergenic
1085387403 11:76164951-76164973 AGAGGGGACACACGCACAGGGGG + Intergenic
1089353908 11:117837494-117837516 GCAGGGGACACATTCCCCAGGGG + Exonic
1101732230 12:107436329-107436351 TCAGGTGACAGATGCCTAAGAGG + Intronic
1104534929 12:129609854-129609876 TCAGGGAACACACTCCCCACTGG + Intronic
1104805234 12:131585826-131585848 TCAGGGGACACAGGACACAGGGG - Intergenic
1109586396 13:64410717-64410739 GCAGGGGGCAGAGGCCCAAGGGG - Intergenic
1119704304 14:76774420-76774442 TCAGGGGTCACACACCAAAGTGG + Intronic
1122313462 14:100811971-100811993 TCAGGGGCCACAGAACCAAGGGG - Intergenic
1124379376 15:29151814-29151836 TGAGGGCACACACGCTGAAGAGG + Exonic
1125640968 15:41230701-41230723 GCCGGGGACACACGCCGCAGAGG + Intronic
1128453823 15:67821991-67822013 AAAGGGGAGACACGCCCCAGAGG + Exonic
1133058124 16:3157716-3157738 AGACGGGACACACGCCCACGAGG - Intergenic
1134049646 16:11128502-11128524 TCAGGGGAGACACAGCCAAGGGG - Intronic
1134060646 16:11197687-11197709 CAAGGGGGCACACGCCCAGGAGG + Intergenic
1142008723 16:87702664-87702686 TCAGGGGAGCCACGCGGAAGAGG + Intronic
1142440715 16:90095807-90095829 TCAGGGGTCGCATGCCCATGAGG + Intergenic
1147458497 17:40553612-40553634 TCTGGTGACACAGGACCAAGAGG - Intergenic
1148460723 17:47837784-47837806 TCAGGGCACCCAGGCCCCAGGGG + Exonic
1152070851 17:78132928-78132950 TCAGGGGACACAAGTCTAAGAGG + Intronic
1152956841 18:47753-47775 TCAGGGGTCGCATGCCCATGAGG - Exonic
1157782066 18:50448448-50448470 ACAGGAGAAACACACCCAAGAGG + Intergenic
1157855372 18:51100288-51100310 TCAGCGGGCACACACACAAGTGG + Intergenic
1161465858 19:4429976-4429998 TCTGGTGACACTCGCCCACGTGG + Intronic
1161769709 19:6224475-6224497 GCAGGGGACACACGCCCAGCTGG + Intronic
1162013943 19:7833622-7833644 TGCTTGGACACACGCCCAAGAGG + Intronic
1162020003 19:7864006-7864028 GCAGGGGACAGACGACCCAGAGG + Intronic
1162081419 19:8220141-8220163 TAAGGGGACACACAGCCGAGGGG - Intronic
1165352054 19:35280938-35280960 TCAGGGTGCACACGGCCCAGGGG - Intronic
1168058422 19:53876737-53876759 TCAGGGGACAGACTCCAAGGAGG - Intergenic
925317518 2:2937331-2937353 TCAGGGGGTGCACGCTCAAGGGG + Intergenic
934569241 2:95358108-95358130 TCAGGGGACATAGGCTCGAGAGG + Intronic
937963516 2:127482693-127482715 TCAGGGCACACACGGGCCAGTGG + Intronic
939131869 2:138244585-138244607 TCATGAGTCACAGGCCCAAGTGG + Intergenic
946427787 2:219608596-219608618 CCAGGGGACACACCAACAAGGGG - Exonic
1172185505 20:33028692-33028714 TTGGGGGACACAAGCCCCAGTGG + Intergenic
1176287914 21:5028596-5028618 TCAGGGGACACACGCCCAAGAGG - Intronic
1179869267 21:44234879-44234901 TCAGGGGACACACGCCCAAGAGG + Intronic
1180087654 21:45515280-45515302 TCAGGGGACACTGGCCCCACAGG - Exonic
1180206573 21:46264811-46264833 TCAGGGGGCACACCCGCCAGGGG + Intronic
1181576893 22:23800940-23800962 TCAGGGAACAGAAGGCCAAGAGG + Exonic
1183898973 22:40990997-40991019 TCAGGGGACAAGAGCCCATGAGG + Intergenic
956664478 3:71629793-71629815 CCAAGGGACCCACCCCCAAGAGG - Intergenic
958591784 3:96168869-96168891 TCAGAGGAAACACGCCCAACAGG - Intergenic
969331031 4:6473452-6473474 GCACGGGACACAAGCCCCAGTGG + Intronic
971240231 4:24881677-24881699 TCAGTGGACACACAGCCCAGGGG - Intronic
973389734 4:49545172-49545194 ACAGGGTATACACACCCAAGAGG - Intergenic
975893502 4:79057966-79057988 TCAGGGAACAATCGCCCATGTGG - Intergenic
984006764 4:174320727-174320749 TCAGTTGACACAGGCCCAAGGGG + Intronic
985806061 5:2044319-2044341 TAAGAGGACACCCCCCCAAGAGG + Intergenic
985913546 5:2900979-2901001 TCAGAGGAGAAAGGCCCAAGTGG - Intergenic
986067278 5:4246851-4246873 TCAGGGGACACAATGCCATGTGG + Intergenic
986230994 5:5864727-5864749 TTAGTGGACACACACACAAGTGG - Intergenic
990598410 5:57333520-57333542 TCAGGGGACTCATGTCCTAGTGG + Intergenic
999802614 5:155051942-155051964 CCAGGGAACACACTCTCAAGAGG - Intergenic
1001782760 5:174384595-174384617 TCAGAGAACGCACGCCGAAGCGG + Intergenic
1006423629 6:33950443-33950465 TCAGGGGACCCAGACCCTAGAGG - Intergenic
1011720664 6:90153251-90153273 TCATGAATCACACGCCCAAGTGG + Intronic
1019451514 7:1101040-1101062 TCAGGGAACACAGGCCCAGGCGG + Intronic
1032073043 7:128821499-128821521 TCAGGGGCCAGACTTCCAAGTGG - Intronic
1034919258 7:155065936-155065958 TCAGGGGAGACCCTTCCAAGGGG - Intergenic
1039588669 8:38728650-38728672 TCTGGGGACCCTCGCCGAAGAGG + Intronic
1055204230 9:73708338-73708360 TCAGGAGACACAGGGCAAAGAGG - Intergenic
1057196785 9:93119937-93119959 TCAGGGCACACACATCCAACTGG + Intergenic
1059082998 9:111269734-111269756 TCAGGTGACACAAGCACAAGAGG - Intergenic
1060662433 9:125412111-125412133 GCAGGGGACACATGGCCATGAGG + Intergenic
1061602307 9:131679247-131679269 TCAGGGAAGACAAGCCTAAGGGG + Intronic
1186726819 X:12366732-12366754 TCCAGTGACACACGGCCAAGTGG + Intronic
1200072641 X:153536698-153536720 TCATGGGACACACACACAGGCGG + Intronic
1201361047 Y:13149111-13149133 TCAGGAGACAGACACACAAGAGG - Intergenic