ID: 1176292591

View in Genome Browser
Species Human (GRCh38)
Location 21:5054082-5054104
Sequence CCCCGCTATCAGGAAGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176292583_1176292591 2 Left 1176292583 21:5054057-5054079 CCCAGTCTCTCCTCATGTCACCA No data
Right 1176292591 21:5054082-5054104 CCCCGCTATCAGGAAGGGACAGG No data
1176292585_1176292591 -8 Left 1176292585 21:5054067-5054089 CCTCATGTCACCACACCCCGCTA No data
Right 1176292591 21:5054082-5054104 CCCCGCTATCAGGAAGGGACAGG No data
1176292584_1176292591 1 Left 1176292584 21:5054058-5054080 CCAGTCTCTCCTCATGTCACCAC No data
Right 1176292591 21:5054082-5054104 CCCCGCTATCAGGAAGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176292591 Original CRISPR CCCCGCTATCAGGAAGGGAC AGG Intergenic
No off target data available for this crispr