ID: 1176293639

View in Genome Browser
Species Human (GRCh38)
Location 21:5059280-5059302
Sequence TGGCAGATGAATGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176293629_1176293639 15 Left 1176293629 21:5059242-5059264 CCTGGCACAGGGCAGGCCCCTCC No data
Right 1176293639 21:5059280-5059302 TGGCAGATGAATGAGGAGGAGGG No data
1176293632_1176293639 -3 Left 1176293632 21:5059260-5059282 CCTCCTCCACATTTCACAGATGG No data
Right 1176293639 21:5059280-5059302 TGGCAGATGAATGAGGAGGAGGG No data
1176293634_1176293639 -6 Left 1176293634 21:5059263-5059285 CCTCCACATTTCACAGATGGCAG No data
Right 1176293639 21:5059280-5059302 TGGCAGATGAATGAGGAGGAGGG No data
1176293631_1176293639 -2 Left 1176293631 21:5059259-5059281 CCCTCCTCCACATTTCACAGATG No data
Right 1176293639 21:5059280-5059302 TGGCAGATGAATGAGGAGGAGGG No data
1176293630_1176293639 -1 Left 1176293630 21:5059258-5059280 CCCCTCCTCCACATTTCACAGAT No data
Right 1176293639 21:5059280-5059302 TGGCAGATGAATGAGGAGGAGGG No data
1176293635_1176293639 -9 Left 1176293635 21:5059266-5059288 CCACATTTCACAGATGGCAGATG No data
Right 1176293639 21:5059280-5059302 TGGCAGATGAATGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176293639 Original CRISPR TGGCAGATGAATGAGGAGGA GGG Intergenic
No off target data available for this crispr