ID: 1176294215

View in Genome Browser
Species Human (GRCh38)
Location 21:5062142-5062164
Sequence TGGCAGGCCCAGGAACCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176294207_1176294215 17 Left 1176294207 21:5062102-5062124 CCCAGCCTTACAGCGAGAGTAAA No data
Right 1176294215 21:5062142-5062164 TGGCAGGCCCAGGAACCTCAGGG No data
1176294209_1176294215 12 Left 1176294209 21:5062107-5062129 CCTTACAGCGAGAGTAAATAAAA No data
Right 1176294215 21:5062142-5062164 TGGCAGGCCCAGGAACCTCAGGG No data
1176294208_1176294215 16 Left 1176294208 21:5062103-5062125 CCAGCCTTACAGCGAGAGTAAAT No data
Right 1176294215 21:5062142-5062164 TGGCAGGCCCAGGAACCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176294215 Original CRISPR TGGCAGGCCCAGGAACCTCA GGG Intergenic
No off target data available for this crispr