ID: 1176294343

View in Genome Browser
Species Human (GRCh38)
Location 21:5063149-5063171
Sequence CAGGGTTGGACCGCAGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176294343_1176294354 14 Left 1176294343 21:5063149-5063171 CCAGCAACTGCGGTCCAACCCTG No data
Right 1176294354 21:5063186-5063208 GCCGCTGATGCTTGTAGACAAGG No data
1176294343_1176294357 16 Left 1176294343 21:5063149-5063171 CCAGCAACTGCGGTCCAACCCTG No data
Right 1176294357 21:5063188-5063210 CGCTGATGCTTGTAGACAAGGGG No data
1176294343_1176294356 15 Left 1176294343 21:5063149-5063171 CCAGCAACTGCGGTCCAACCCTG No data
Right 1176294356 21:5063187-5063209 CCGCTGATGCTTGTAGACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176294343 Original CRISPR CAGGGTTGGACCGCAGTTGC TGG (reversed) Intergenic
No off target data available for this crispr