ID: 1176294343 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:5063149-5063171 |
| Sequence | CAGGGTTGGACCGCAGTTGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1176294343_1176294354 | 14 | Left | 1176294343 | 21:5063149-5063171 | CCAGCAACTGCGGTCCAACCCTG | No data | ||
| Right | 1176294354 | 21:5063186-5063208 | GCCGCTGATGCTTGTAGACAAGG | No data | ||||
| 1176294343_1176294357 | 16 | Left | 1176294343 | 21:5063149-5063171 | CCAGCAACTGCGGTCCAACCCTG | No data | ||
| Right | 1176294357 | 21:5063188-5063210 | CGCTGATGCTTGTAGACAAGGGG | No data | ||||
| 1176294343_1176294356 | 15 | Left | 1176294343 | 21:5063149-5063171 | CCAGCAACTGCGGTCCAACCCTG | No data | ||
| Right | 1176294356 | 21:5063187-5063209 | CCGCTGATGCTTGTAGACAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1176294343 | Original CRISPR | CAGGGTTGGACCGCAGTTGC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||