ID: 1176295245

View in Genome Browser
Species Human (GRCh38)
Location 21:5068694-5068716
Sequence CTGAATGTGCACATGGACAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176295243_1176295245 25 Left 1176295243 21:5068646-5068668 CCTTTGCAACTACTTAAACTTAC No data
Right 1176295245 21:5068694-5068716 CTGAATGTGCACATGGACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176295245 Original CRISPR CTGAATGTGCACATGGACAG CGG Intergenic
No off target data available for this crispr