ID: 1176295245 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:5068694-5068716 |
| Sequence | CTGAATGTGCACATGGACAG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1176295243_1176295245 | 25 | Left | 1176295243 | 21:5068646-5068668 | CCTTTGCAACTACTTAAACTTAC | No data | ||
| Right | 1176295245 | 21:5068694-5068716 | CTGAATGTGCACATGGACAGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1176295245 | Original CRISPR | CTGAATGTGCACATGGACAG CGG | Intergenic | ||
| No off target data available for this crispr | |||||