ID: 1176297343

View in Genome Browser
Species Human (GRCh38)
Location 21:5081125-5081147
Sequence GAGGAAGGAGTGGGCCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176297343_1176297350 25 Left 1176297343 21:5081125-5081147 CCTCCAGGGCCCACTCCTTCCTC No data
Right 1176297350 21:5081173-5081195 TTAGTGCATGAATCCCATCCTGG No data
1176297343_1176297351 26 Left 1176297343 21:5081125-5081147 CCTCCAGGGCCCACTCCTTCCTC No data
Right 1176297351 21:5081174-5081196 TAGTGCATGAATCCCATCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176297343 Original CRISPR GAGGAAGGAGTGGGCCCTGG AGG (reversed) Intergenic
No off target data available for this crispr