ID: 1176298098

View in Genome Browser
Species Human (GRCh38)
Location 21:5085064-5085086
Sequence GGCGCTGTTCCCCCAGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176298098_1176298100 -10 Left 1176298098 21:5085064-5085086 CCCTGTGCTGGGGGAACAGCGCC No data
Right 1176298100 21:5085077-5085099 GAACAGCGCCTCCCAAAATCAGG No data
1176298098_1176298105 10 Left 1176298098 21:5085064-5085086 CCCTGTGCTGGGGGAACAGCGCC No data
Right 1176298105 21:5085097-5085119 AGGTCCCCTGGAACCCAAGAAGG No data
1176298098_1176298110 23 Left 1176298098 21:5085064-5085086 CCCTGTGCTGGGGGAACAGCGCC No data
Right 1176298110 21:5085110-5085132 CCCAAGAAGGCGACTTTATTTGG No data
1176298098_1176298102 -2 Left 1176298098 21:5085064-5085086 CCCTGTGCTGGGGGAACAGCGCC No data
Right 1176298102 21:5085085-5085107 CCTCCCAAAATCAGGTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176298098 Original CRISPR GGCGCTGTTCCCCCAGCACA GGG (reversed) Intergenic
No off target data available for this crispr