ID: 1176298819

View in Genome Browser
Species Human (GRCh38)
Location 21:5088828-5088850
Sequence GTGGAGGAGCCGCCTCCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176298819_1176298827 15 Left 1176298819 21:5088828-5088850 CCGCCTGGAGGCGGCTCCTCCAC No data
Right 1176298827 21:5088866-5088888 TTTCTGCAGCAGTTGCCTGCCGG No data
1176298819_1176298828 29 Left 1176298819 21:5088828-5088850 CCGCCTGGAGGCGGCTCCTCCAC No data
Right 1176298828 21:5088880-5088902 GCCTGCCGGACTCCAGCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176298819 Original CRISPR GTGGAGGAGCCGCCTCCAGG CGG (reversed) Intergenic