ID: 1176298820

View in Genome Browser
Species Human (GRCh38)
Location 21:5088831-5088853
Sequence CAGGTGGAGGAGCCGCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176298820_1176298828 26 Left 1176298820 21:5088831-5088853 CCTGGAGGCGGCTCCTCCACCTG No data
Right 1176298828 21:5088880-5088902 GCCTGCCGGACTCCAGCCCGAGG No data
1176298820_1176298830 29 Left 1176298820 21:5088831-5088853 CCTGGAGGCGGCTCCTCCACCTG No data
Right 1176298830 21:5088883-5088905 TGCCGGACTCCAGCCCGAGGCGG No data
1176298820_1176298831 30 Left 1176298820 21:5088831-5088853 CCTGGAGGCGGCTCCTCCACCTG No data
Right 1176298831 21:5088884-5088906 GCCGGACTCCAGCCCGAGGCGGG No data
1176298820_1176298827 12 Left 1176298820 21:5088831-5088853 CCTGGAGGCGGCTCCTCCACCTG No data
Right 1176298827 21:5088866-5088888 TTTCTGCAGCAGTTGCCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176298820 Original CRISPR CAGGTGGAGGAGCCGCCTCC AGG (reversed) Intergenic
No off target data available for this crispr