ID: 1176298822

View in Genome Browser
Species Human (GRCh38)
Location 21:5088847-5088869
Sequence GAAACGGAGGCAGAGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176298822_1176298830 13 Left 1176298822 21:5088847-5088869 CCACCTGCCTCTGCCTCCGTTTC No data
Right 1176298830 21:5088883-5088905 TGCCGGACTCCAGCCCGAGGCGG No data
1176298822_1176298827 -4 Left 1176298822 21:5088847-5088869 CCACCTGCCTCTGCCTCCGTTTC No data
Right 1176298827 21:5088866-5088888 TTTCTGCAGCAGTTGCCTGCCGG No data
1176298822_1176298828 10 Left 1176298822 21:5088847-5088869 CCACCTGCCTCTGCCTCCGTTTC No data
Right 1176298828 21:5088880-5088902 GCCTGCCGGACTCCAGCCCGAGG No data
1176298822_1176298834 16 Left 1176298822 21:5088847-5088869 CCACCTGCCTCTGCCTCCGTTTC No data
Right 1176298834 21:5088886-5088908 CGGACTCCAGCCCGAGGCGGGGG No data
1176298822_1176298836 22 Left 1176298822 21:5088847-5088869 CCACCTGCCTCTGCCTCCGTTTC No data
Right 1176298836 21:5088892-5088914 CCAGCCCGAGGCGGGGGCCACGG No data
1176298822_1176298833 15 Left 1176298822 21:5088847-5088869 CCACCTGCCTCTGCCTCCGTTTC No data
Right 1176298833 21:5088885-5088907 CCGGACTCCAGCCCGAGGCGGGG No data
1176298822_1176298831 14 Left 1176298822 21:5088847-5088869 CCACCTGCCTCTGCCTCCGTTTC No data
Right 1176298831 21:5088884-5088906 GCCGGACTCCAGCCCGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176298822 Original CRISPR GAAACGGAGGCAGAGGCAGG TGG (reversed) Intergenic
No off target data available for this crispr