ID: 1176298823

View in Genome Browser
Species Human (GRCh38)
Location 21:5088850-5088872
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176298823_1176298836 19 Left 1176298823 21:5088850-5088872 CCTGCCTCTGCCTCCGTTTCTGC No data
Right 1176298836 21:5088892-5088914 CCAGCCCGAGGCGGGGGCCACGG No data
1176298823_1176298830 10 Left 1176298823 21:5088850-5088872 CCTGCCTCTGCCTCCGTTTCTGC No data
Right 1176298830 21:5088883-5088905 TGCCGGACTCCAGCCCGAGGCGG No data
1176298823_1176298827 -7 Left 1176298823 21:5088850-5088872 CCTGCCTCTGCCTCCGTTTCTGC No data
Right 1176298827 21:5088866-5088888 TTTCTGCAGCAGTTGCCTGCCGG No data
1176298823_1176298828 7 Left 1176298823 21:5088850-5088872 CCTGCCTCTGCCTCCGTTTCTGC No data
Right 1176298828 21:5088880-5088902 GCCTGCCGGACTCCAGCCCGAGG No data
1176298823_1176298834 13 Left 1176298823 21:5088850-5088872 CCTGCCTCTGCCTCCGTTTCTGC No data
Right 1176298834 21:5088886-5088908 CGGACTCCAGCCCGAGGCGGGGG No data
1176298823_1176298833 12 Left 1176298823 21:5088850-5088872 CCTGCCTCTGCCTCCGTTTCTGC No data
Right 1176298833 21:5088885-5088907 CCGGACTCCAGCCCGAGGCGGGG No data
1176298823_1176298831 11 Left 1176298823 21:5088850-5088872 CCTGCCTCTGCCTCCGTTTCTGC No data
Right 1176298831 21:5088884-5088906 GCCGGACTCCAGCCCGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176298823 Original CRISPR GCAGAAACGGAGGCAGAGGC AGG (reversed) Intergenic