ID: 1176298826

View in Genome Browser
Species Human (GRCh38)
Location 21:5088863-5088885
Sequence GCAGGCAACTGCTGCAGAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176298826_1176298839 19 Left 1176298826 21:5088863-5088885 CCGTTTCTGCAGCAGTTGCCTGC No data
Right 1176298839 21:5088905-5088927 GGGGCCACGGCTGACCCAGCTGG No data
1176298826_1176298828 -6 Left 1176298826 21:5088863-5088885 CCGTTTCTGCAGCAGTTGCCTGC No data
Right 1176298828 21:5088880-5088902 GCCTGCCGGACTCCAGCCCGAGG No data
1176298826_1176298830 -3 Left 1176298826 21:5088863-5088885 CCGTTTCTGCAGCAGTTGCCTGC No data
Right 1176298830 21:5088883-5088905 TGCCGGACTCCAGCCCGAGGCGG No data
1176298826_1176298833 -1 Left 1176298826 21:5088863-5088885 CCGTTTCTGCAGCAGTTGCCTGC No data
Right 1176298833 21:5088885-5088907 CCGGACTCCAGCCCGAGGCGGGG No data
1176298826_1176298831 -2 Left 1176298826 21:5088863-5088885 CCGTTTCTGCAGCAGTTGCCTGC No data
Right 1176298831 21:5088884-5088906 GCCGGACTCCAGCCCGAGGCGGG No data
1176298826_1176298836 6 Left 1176298826 21:5088863-5088885 CCGTTTCTGCAGCAGTTGCCTGC No data
Right 1176298836 21:5088892-5088914 CCAGCCCGAGGCGGGGGCCACGG No data
1176298826_1176298834 0 Left 1176298826 21:5088863-5088885 CCGTTTCTGCAGCAGTTGCCTGC No data
Right 1176298834 21:5088886-5088908 CGGACTCCAGCCCGAGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176298826 Original CRISPR GCAGGCAACTGCTGCAGAAA CGG (reversed) Intergenic