ID: 1176298827

View in Genome Browser
Species Human (GRCh38)
Location 21:5088866-5088888
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176298818_1176298827 18 Left 1176298818 21:5088825-5088847 CCTCCGCCTGGAGGCGGCTCCTC No data
Right 1176298827 21:5088866-5088888 TTTCTGCAGCAGTTGCCTGCCGG No data
1176298819_1176298827 15 Left 1176298819 21:5088828-5088850 CCGCCTGGAGGCGGCTCCTCCAC No data
Right 1176298827 21:5088866-5088888 TTTCTGCAGCAGTTGCCTGCCGG No data
1176298821_1176298827 -1 Left 1176298821 21:5088844-5088866 CCTCCACCTGCCTCTGCCTCCGT No data
Right 1176298827 21:5088866-5088888 TTTCTGCAGCAGTTGCCTGCCGG No data
1176298820_1176298827 12 Left 1176298820 21:5088831-5088853 CCTGGAGGCGGCTCCTCCACCTG No data
Right 1176298827 21:5088866-5088888 TTTCTGCAGCAGTTGCCTGCCGG No data
1176298823_1176298827 -7 Left 1176298823 21:5088850-5088872 CCTGCCTCTGCCTCCGTTTCTGC No data
Right 1176298827 21:5088866-5088888 TTTCTGCAGCAGTTGCCTGCCGG No data
1176298822_1176298827 -4 Left 1176298822 21:5088847-5088869 CCACCTGCCTCTGCCTCCGTTTC No data
Right 1176298827 21:5088866-5088888 TTTCTGCAGCAGTTGCCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176298827 Original CRISPR TTTCTGCAGCAGTTGCCTGC CGG Intergenic