ID: 1176298828

View in Genome Browser
Species Human (GRCh38)
Location 21:5088880-5088902
Sequence GCCTGCCGGACTCCAGCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176298820_1176298828 26 Left 1176298820 21:5088831-5088853 CCTGGAGGCGGCTCCTCCACCTG No data
Right 1176298828 21:5088880-5088902 GCCTGCCGGACTCCAGCCCGAGG No data
1176298821_1176298828 13 Left 1176298821 21:5088844-5088866 CCTCCACCTGCCTCTGCCTCCGT No data
Right 1176298828 21:5088880-5088902 GCCTGCCGGACTCCAGCCCGAGG No data
1176298823_1176298828 7 Left 1176298823 21:5088850-5088872 CCTGCCTCTGCCTCCGTTTCTGC No data
Right 1176298828 21:5088880-5088902 GCCTGCCGGACTCCAGCCCGAGG No data
1176298822_1176298828 10 Left 1176298822 21:5088847-5088869 CCACCTGCCTCTGCCTCCGTTTC No data
Right 1176298828 21:5088880-5088902 GCCTGCCGGACTCCAGCCCGAGG No data
1176298826_1176298828 -6 Left 1176298826 21:5088863-5088885 CCGTTTCTGCAGCAGTTGCCTGC No data
Right 1176298828 21:5088880-5088902 GCCTGCCGGACTCCAGCCCGAGG No data
1176298824_1176298828 3 Left 1176298824 21:5088854-5088876 CCTCTGCCTCCGTTTCTGCAGCA No data
Right 1176298828 21:5088880-5088902 GCCTGCCGGACTCCAGCCCGAGG No data
1176298825_1176298828 -3 Left 1176298825 21:5088860-5088882 CCTCCGTTTCTGCAGCAGTTGCC No data
Right 1176298828 21:5088880-5088902 GCCTGCCGGACTCCAGCCCGAGG No data
1176298819_1176298828 29 Left 1176298819 21:5088828-5088850 CCGCCTGGAGGCGGCTCCTCCAC No data
Right 1176298828 21:5088880-5088902 GCCTGCCGGACTCCAGCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176298828 Original CRISPR GCCTGCCGGACTCCAGCCCG AGG Intergenic
No off target data available for this crispr