ID: 1176298829

View in Genome Browser
Species Human (GRCh38)
Location 21:5088881-5088903
Sequence GCCTCGGGCTGGAGTCCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176298829_1176298839 1 Left 1176298829 21:5088881-5088903 CCTGCCGGACTCCAGCCCGAGGC No data
Right 1176298839 21:5088905-5088927 GGGGCCACGGCTGACCCAGCTGG No data
1176298829_1176298843 16 Left 1176298829 21:5088881-5088903 CCTGCCGGACTCCAGCCCGAGGC No data
Right 1176298843 21:5088920-5088942 CCAGCTGGAGAACGCCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176298829 Original CRISPR GCCTCGGGCTGGAGTCCGGC AGG (reversed) Intergenic
No off target data available for this crispr