ID: 1176298833

View in Genome Browser
Species Human (GRCh38)
Location 21:5088885-5088907
Sequence CCGGACTCCAGCCCGAGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176298826_1176298833 -1 Left 1176298826 21:5088863-5088885 CCGTTTCTGCAGCAGTTGCCTGC No data
Right 1176298833 21:5088885-5088907 CCGGACTCCAGCCCGAGGCGGGG No data
1176298822_1176298833 15 Left 1176298822 21:5088847-5088869 CCACCTGCCTCTGCCTCCGTTTC No data
Right 1176298833 21:5088885-5088907 CCGGACTCCAGCCCGAGGCGGGG No data
1176298823_1176298833 12 Left 1176298823 21:5088850-5088872 CCTGCCTCTGCCTCCGTTTCTGC No data
Right 1176298833 21:5088885-5088907 CCGGACTCCAGCCCGAGGCGGGG No data
1176298825_1176298833 2 Left 1176298825 21:5088860-5088882 CCTCCGTTTCTGCAGCAGTTGCC No data
Right 1176298833 21:5088885-5088907 CCGGACTCCAGCCCGAGGCGGGG No data
1176298824_1176298833 8 Left 1176298824 21:5088854-5088876 CCTCTGCCTCCGTTTCTGCAGCA No data
Right 1176298833 21:5088885-5088907 CCGGACTCCAGCCCGAGGCGGGG No data
1176298821_1176298833 18 Left 1176298821 21:5088844-5088866 CCTCCACCTGCCTCTGCCTCCGT No data
Right 1176298833 21:5088885-5088907 CCGGACTCCAGCCCGAGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176298833 Original CRISPR CCGGACTCCAGCCCGAGGCG GGG Intergenic
No off target data available for this crispr