ID: 1176298835

View in Genome Browser
Species Human (GRCh38)
Location 21:5088892-5088914
Sequence CCGTGGCCCCCGCCTCGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176298835_1176298843 5 Left 1176298835 21:5088892-5088914 CCAGCCCGAGGCGGGGGCCACGG No data
Right 1176298843 21:5088920-5088942 CCAGCTGGAGAACGCCCCACTGG No data
1176298835_1176298839 -10 Left 1176298835 21:5088892-5088914 CCAGCCCGAGGCGGGGGCCACGG No data
Right 1176298839 21:5088905-5088927 GGGGCCACGGCTGACCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176298835 Original CRISPR CCGTGGCCCCCGCCTCGGGC TGG (reversed) Intergenic