ID: 1176298838

View in Genome Browser
Species Human (GRCh38)
Location 21:5088897-5088919
Sequence GTCAGCCGTGGCCCCCGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176298838_1176298843 0 Left 1176298838 21:5088897-5088919 CCGAGGCGGGGGCCACGGCTGAC No data
Right 1176298843 21:5088920-5088942 CCAGCTGGAGAACGCCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176298838 Original CRISPR GTCAGCCGTGGCCCCCGCCT CGG (reversed) Intergenic