ID: 1176298839

View in Genome Browser
Species Human (GRCh38)
Location 21:5088905-5088927
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176298832_1176298839 -3 Left 1176298832 21:5088885-5088907 CCGGACTCCAGCCCGAGGCGGGG No data
Right 1176298839 21:5088905-5088927 GGGGCCACGGCTGACCCAGCTGG No data
1176298829_1176298839 1 Left 1176298829 21:5088881-5088903 CCTGCCGGACTCCAGCCCGAGGC No data
Right 1176298839 21:5088905-5088927 GGGGCCACGGCTGACCCAGCTGG No data
1176298825_1176298839 22 Left 1176298825 21:5088860-5088882 CCTCCGTTTCTGCAGCAGTTGCC No data
Right 1176298839 21:5088905-5088927 GGGGCCACGGCTGACCCAGCTGG No data
1176298824_1176298839 28 Left 1176298824 21:5088854-5088876 CCTCTGCCTCCGTTTCTGCAGCA No data
Right 1176298839 21:5088905-5088927 GGGGCCACGGCTGACCCAGCTGG No data
1176298826_1176298839 19 Left 1176298826 21:5088863-5088885 CCGTTTCTGCAGCAGTTGCCTGC No data
Right 1176298839 21:5088905-5088927 GGGGCCACGGCTGACCCAGCTGG No data
1176298835_1176298839 -10 Left 1176298835 21:5088892-5088914 CCAGCCCGAGGCGGGGGCCACGG No data
Right 1176298839 21:5088905-5088927 GGGGCCACGGCTGACCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176298839 Original CRISPR GGGGCCACGGCTGACCCAGC TGG Intergenic