ID: 1176298843

View in Genome Browser
Species Human (GRCh38)
Location 21:5088920-5088942
Sequence CCAGCTGGAGAACGCCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176298832_1176298843 12 Left 1176298832 21:5088885-5088907 CCGGACTCCAGCCCGAGGCGGGG No data
Right 1176298843 21:5088920-5088942 CCAGCTGGAGAACGCCCCACTGG No data
1176298835_1176298843 5 Left 1176298835 21:5088892-5088914 CCAGCCCGAGGCGGGGGCCACGG No data
Right 1176298843 21:5088920-5088942 CCAGCTGGAGAACGCCCCACTGG No data
1176298838_1176298843 0 Left 1176298838 21:5088897-5088919 CCGAGGCGGGGGCCACGGCTGAC No data
Right 1176298843 21:5088920-5088942 CCAGCTGGAGAACGCCCCACTGG No data
1176298829_1176298843 16 Left 1176298829 21:5088881-5088903 CCTGCCGGACTCCAGCCCGAGGC No data
Right 1176298843 21:5088920-5088942 CCAGCTGGAGAACGCCCCACTGG No data
1176298837_1176298843 1 Left 1176298837 21:5088896-5088918 CCCGAGGCGGGGGCCACGGCTGA No data
Right 1176298843 21:5088920-5088942 CCAGCTGGAGAACGCCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176298843 Original CRISPR CCAGCTGGAGAACGCCCCAC TGG Intergenic