ID: 1176300145

View in Genome Browser
Species Human (GRCh38)
Location 21:5095474-5095496
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176300145_1176300157 19 Left 1176300145 21:5095474-5095496 CCACTTGAGGCCTCCGGCTCTGA No data
Right 1176300157 21:5095516-5095538 GGTTTGGTGCAGCCTCTGATGGG No data
1176300145_1176300150 -4 Left 1176300145 21:5095474-5095496 CCACTTGAGGCCTCCGGCTCTGA No data
Right 1176300150 21:5095493-5095515 CTGATCGCCCAGAGGGCGCACGG No data
1176300145_1176300158 26 Left 1176300145 21:5095474-5095496 CCACTTGAGGCCTCCGGCTCTGA No data
Right 1176300158 21:5095523-5095545 TGCAGCCTCTGATGGGCACGAGG No data
1176300145_1176300151 -3 Left 1176300145 21:5095474-5095496 CCACTTGAGGCCTCCGGCTCTGA No data
Right 1176300151 21:5095494-5095516 TGATCGCCCAGAGGGCGCACGGG No data
1176300145_1176300156 18 Left 1176300145 21:5095474-5095496 CCACTTGAGGCCTCCGGCTCTGA No data
Right 1176300156 21:5095515-5095537 GGGTTTGGTGCAGCCTCTGATGG No data
1176300145_1176300152 -2 Left 1176300145 21:5095474-5095496 CCACTTGAGGCCTCCGGCTCTGA No data
Right 1176300152 21:5095495-5095517 GATCGCCCAGAGGGCGCACGGGG No data
1176300145_1176300159 29 Left 1176300145 21:5095474-5095496 CCACTTGAGGCCTCCGGCTCTGA No data
Right 1176300159 21:5095526-5095548 AGCCTCTGATGGGCACGAGGCGG No data
1176300145_1176300154 3 Left 1176300145 21:5095474-5095496 CCACTTGAGGCCTCCGGCTCTGA No data
Right 1176300154 21:5095500-5095522 CCCAGAGGGCGCACGGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176300145 Original CRISPR TCAGAGCCGGAGGCCTCAAG TGG (reversed) Intergenic