ID: 1176300149

View in Genome Browser
Species Human (GRCh38)
Location 21:5095487-5095509
Sequence GCCCTCTGGGCGATCAGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176300149_1176300159 16 Left 1176300149 21:5095487-5095509 CCGGCTCTGATCGCCCAGAGGGC No data
Right 1176300159 21:5095526-5095548 AGCCTCTGATGGGCACGAGGCGG No data
1176300149_1176300154 -10 Left 1176300149 21:5095487-5095509 CCGGCTCTGATCGCCCAGAGGGC No data
Right 1176300154 21:5095500-5095522 CCCAGAGGGCGCACGGGGTTTGG No data
1176300149_1176300157 6 Left 1176300149 21:5095487-5095509 CCGGCTCTGATCGCCCAGAGGGC No data
Right 1176300157 21:5095516-5095538 GGTTTGGTGCAGCCTCTGATGGG No data
1176300149_1176300162 25 Left 1176300149 21:5095487-5095509 CCGGCTCTGATCGCCCAGAGGGC No data
Right 1176300162 21:5095535-5095557 TGGGCACGAGGCGGCCGCACGGG No data
1176300149_1176300156 5 Left 1176300149 21:5095487-5095509 CCGGCTCTGATCGCCCAGAGGGC No data
Right 1176300156 21:5095515-5095537 GGGTTTGGTGCAGCCTCTGATGG No data
1176300149_1176300161 24 Left 1176300149 21:5095487-5095509 CCGGCTCTGATCGCCCAGAGGGC No data
Right 1176300161 21:5095534-5095556 ATGGGCACGAGGCGGCCGCACGG No data
1176300149_1176300158 13 Left 1176300149 21:5095487-5095509 CCGGCTCTGATCGCCCAGAGGGC No data
Right 1176300158 21:5095523-5095545 TGCAGCCTCTGATGGGCACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176300149 Original CRISPR GCCCTCTGGGCGATCAGAGC CGG (reversed) Intergenic