ID: 1176300153

View in Genome Browser
Species Human (GRCh38)
Location 21:5095500-5095522
Sequence CCAAACCCCGTGCGCCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176300153_1176300162 12 Left 1176300153 21:5095500-5095522 CCCAGAGGGCGCACGGGGTTTGG No data
Right 1176300162 21:5095535-5095557 TGGGCACGAGGCGGCCGCACGGG No data
1176300153_1176300157 -7 Left 1176300153 21:5095500-5095522 CCCAGAGGGCGCACGGGGTTTGG No data
Right 1176300157 21:5095516-5095538 GGTTTGGTGCAGCCTCTGATGGG No data
1176300153_1176300161 11 Left 1176300153 21:5095500-5095522 CCCAGAGGGCGCACGGGGTTTGG No data
Right 1176300161 21:5095534-5095556 ATGGGCACGAGGCGGCCGCACGG No data
1176300153_1176300159 3 Left 1176300153 21:5095500-5095522 CCCAGAGGGCGCACGGGGTTTGG No data
Right 1176300159 21:5095526-5095548 AGCCTCTGATGGGCACGAGGCGG No data
1176300153_1176300165 26 Left 1176300153 21:5095500-5095522 CCCAGAGGGCGCACGGGGTTTGG No data
Right 1176300165 21:5095549-5095571 CCGCACGGGATGAGCACAGTGGG No data
1176300153_1176300158 0 Left 1176300153 21:5095500-5095522 CCCAGAGGGCGCACGGGGTTTGG No data
Right 1176300158 21:5095523-5095545 TGCAGCCTCTGATGGGCACGAGG No data
1176300153_1176300156 -8 Left 1176300153 21:5095500-5095522 CCCAGAGGGCGCACGGGGTTTGG No data
Right 1176300156 21:5095515-5095537 GGGTTTGGTGCAGCCTCTGATGG No data
1176300153_1176300163 25 Left 1176300153 21:5095500-5095522 CCCAGAGGGCGCACGGGGTTTGG No data
Right 1176300163 21:5095548-5095570 GCCGCACGGGATGAGCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176300153 Original CRISPR CCAAACCCCGTGCGCCCTCT GGG (reversed) Intergenic