ID: 1176300155

View in Genome Browser
Species Human (GRCh38)
Location 21:5095501-5095523
Sequence ACCAAACCCCGTGCGCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176300155_1176300165 25 Left 1176300155 21:5095501-5095523 CCAGAGGGCGCACGGGGTTTGGT No data
Right 1176300165 21:5095549-5095571 CCGCACGGGATGAGCACAGTGGG No data
1176300155_1176300161 10 Left 1176300155 21:5095501-5095523 CCAGAGGGCGCACGGGGTTTGGT No data
Right 1176300161 21:5095534-5095556 ATGGGCACGAGGCGGCCGCACGG No data
1176300155_1176300163 24 Left 1176300155 21:5095501-5095523 CCAGAGGGCGCACGGGGTTTGGT No data
Right 1176300163 21:5095548-5095570 GCCGCACGGGATGAGCACAGTGG No data
1176300155_1176300158 -1 Left 1176300155 21:5095501-5095523 CCAGAGGGCGCACGGGGTTTGGT No data
Right 1176300158 21:5095523-5095545 TGCAGCCTCTGATGGGCACGAGG No data
1176300155_1176300157 -8 Left 1176300155 21:5095501-5095523 CCAGAGGGCGCACGGGGTTTGGT No data
Right 1176300157 21:5095516-5095538 GGTTTGGTGCAGCCTCTGATGGG No data
1176300155_1176300162 11 Left 1176300155 21:5095501-5095523 CCAGAGGGCGCACGGGGTTTGGT No data
Right 1176300162 21:5095535-5095557 TGGGCACGAGGCGGCCGCACGGG No data
1176300155_1176300156 -9 Left 1176300155 21:5095501-5095523 CCAGAGGGCGCACGGGGTTTGGT No data
Right 1176300156 21:5095515-5095537 GGGTTTGGTGCAGCCTCTGATGG No data
1176300155_1176300159 2 Left 1176300155 21:5095501-5095523 CCAGAGGGCGCACGGGGTTTGGT No data
Right 1176300159 21:5095526-5095548 AGCCTCTGATGGGCACGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176300155 Original CRISPR ACCAAACCCCGTGCGCCCTC TGG (reversed) Intergenic