ID: 1176300156

View in Genome Browser
Species Human (GRCh38)
Location 21:5095515-5095537
Sequence GGGTTTGGTGCAGCCTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176300149_1176300156 5 Left 1176300149 21:5095487-5095509 CCGGCTCTGATCGCCCAGAGGGC No data
Right 1176300156 21:5095515-5095537 GGGTTTGGTGCAGCCTCTGATGG No data
1176300155_1176300156 -9 Left 1176300155 21:5095501-5095523 CCAGAGGGCGCACGGGGTTTGGT No data
Right 1176300156 21:5095515-5095537 GGGTTTGGTGCAGCCTCTGATGG No data
1176300153_1176300156 -8 Left 1176300153 21:5095500-5095522 CCCAGAGGGCGCACGGGGTTTGG No data
Right 1176300156 21:5095515-5095537 GGGTTTGGTGCAGCCTCTGATGG No data
1176300146_1176300156 8 Left 1176300146 21:5095484-5095506 CCTCCGGCTCTGATCGCCCAGAG No data
Right 1176300156 21:5095515-5095537 GGGTTTGGTGCAGCCTCTGATGG No data
1176300145_1176300156 18 Left 1176300145 21:5095474-5095496 CCACTTGAGGCCTCCGGCTCTGA No data
Right 1176300156 21:5095515-5095537 GGGTTTGGTGCAGCCTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176300156 Original CRISPR GGGTTTGGTGCAGCCTCTGA TGG Intergenic
No off target data available for this crispr