ID: 1176300172

View in Genome Browser
Species Human (GRCh38)
Location 21:5095581-5095603
Sequence CAGCCTGGAGTCCTGGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176300172_1176300185 21 Left 1176300172 21:5095581-5095603 CCCATGGCCAGGACTCCAGGCTG No data
Right 1176300185 21:5095625-5095647 CCACACTGGAAGGCACCCCATGG No data
1176300172_1176300186 30 Left 1176300172 21:5095581-5095603 CCCATGGCCAGGACTCCAGGCTG No data
Right 1176300186 21:5095634-5095656 AAGGCACCCCATGGATATGCTGG No data
1176300172_1176300180 11 Left 1176300172 21:5095581-5095603 CCCATGGCCAGGACTCCAGGCTG No data
Right 1176300180 21:5095615-5095637 TTCCCGAAACCCACACTGGAAGG No data
1176300172_1176300179 7 Left 1176300172 21:5095581-5095603 CCCATGGCCAGGACTCCAGGCTG No data
Right 1176300179 21:5095611-5095633 GAGGTTCCCGAAACCCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176300172 Original CRISPR CAGCCTGGAGTCCTGGCCAT GGG (reversed) Intergenic
No off target data available for this crispr