ID: 1176300705

View in Genome Browser
Species Human (GRCh38)
Location 21:5097641-5097663
Sequence GGCGGACGCGTCGCTTCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176300701_1176300705 -7 Left 1176300701 21:5097625-5097647 CCTTCCCGAGGTTCCAGGCGGAC No data
Right 1176300705 21:5097641-5097663 GGCGGACGCGTCGCTTCCCGAGG No data
1176300693_1176300705 21 Left 1176300693 21:5097597-5097619 CCTTCCCGAGGTTCCAGGCGGAC No data
Right 1176300705 21:5097641-5097663 GGCGGACGCGTCGCTTCCCGAGG No data
1176300694_1176300705 17 Left 1176300694 21:5097601-5097623 CCCGAGGTTCCAGGCGGACGTGT No data
Right 1176300705 21:5097641-5097663 GGCGGACGCGTCGCTTCCCGAGG No data
1176300700_1176300705 -6 Left 1176300700 21:5097624-5097646 CCCTTCCCGAGGTTCCAGGCGGA No data
Right 1176300705 21:5097641-5097663 GGCGGACGCGTCGCTTCCCGAGG No data
1176300696_1176300705 8 Left 1176300696 21:5097610-5097632 CCAGGCGGACGTGTCCCTTCCCG No data
Right 1176300705 21:5097641-5097663 GGCGGACGCGTCGCTTCCCGAGG No data
1176300695_1176300705 16 Left 1176300695 21:5097602-5097624 CCGAGGTTCCAGGCGGACGTGTC No data
Right 1176300705 21:5097641-5097663 GGCGGACGCGTCGCTTCCCGAGG No data
1176300692_1176300705 22 Left 1176300692 21:5097596-5097618 CCCTTCCCGAGGTTCCAGGCGGA No data
Right 1176300705 21:5097641-5097663 GGCGGACGCGTCGCTTCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176300705 Original CRISPR GGCGGACGCGTCGCTTCCCG AGG Intergenic