ID: 1176301419

View in Genome Browser
Species Human (GRCh38)
Location 21:5100783-5100805
Sequence GCCCATGAGAAGCGGGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176301407_1176301419 14 Left 1176301407 21:5100746-5100768 CCCAGGGAGTTTTACAGATGCTG No data
Right 1176301419 21:5100783-5100805 GCCCATGAGAAGCGGGCGGCGGG No data
1176301408_1176301419 13 Left 1176301408 21:5100747-5100769 CCAGGGAGTTTTACAGATGCTGG No data
Right 1176301419 21:5100783-5100805 GCCCATGAGAAGCGGGCGGCGGG No data
1176301406_1176301419 17 Left 1176301406 21:5100743-5100765 CCTCCCAGGGAGTTTTACAGATG No data
Right 1176301419 21:5100783-5100805 GCCCATGAGAAGCGGGCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176301419 Original CRISPR GCCCATGAGAAGCGGGCGGC GGG Intergenic