ID: 1176302698

View in Genome Browser
Species Human (GRCh38)
Location 21:5106121-5106143
Sequence CACACCTTCCGAATTTTCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176302698_1176302699 -4 Left 1176302698 21:5106121-5106143 CCTCGGAAAATTCGGAAGGTGTG No data
Right 1176302699 21:5106140-5106162 TGTGTCCCAGCCGCAGCCTGAGG No data
1176302698_1176302704 9 Left 1176302698 21:5106121-5106143 CCTCGGAAAATTCGGAAGGTGTG No data
Right 1176302704 21:5106153-5106175 CAGCCTGAGGACCGGCAATGTGG No data
1176302698_1176302701 1 Left 1176302698 21:5106121-5106143 CCTCGGAAAATTCGGAAGGTGTG No data
Right 1176302701 21:5106145-5106167 CCCAGCCGCAGCCTGAGGACCGG No data
1176302698_1176302705 10 Left 1176302698 21:5106121-5106143 CCTCGGAAAATTCGGAAGGTGTG No data
Right 1176302705 21:5106154-5106176 AGCCTGAGGACCGGCAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176302698 Original CRISPR CACACCTTCCGAATTTTCCG AGG (reversed) Intergenic
No off target data available for this crispr