ID: 1176302723

View in Genome Browser
Species Human (GRCh38)
Location 21:5106232-5106254
Sequence GGCTCCCGCCTCTGCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176302723_1176302736 29 Left 1176302723 21:5106232-5106254 CCCACCAGGCAGAGGCGGGAGCC No data
Right 1176302736 21:5106284-5106306 ACTGCCACCACCACAGGAGCGGG No data
1176302723_1176302733 23 Left 1176302723 21:5106232-5106254 CCCACCAGGCAGAGGCGGGAGCC No data
Right 1176302733 21:5106278-5106300 CCCTGGACTGCCACCACCACAGG No data
1176302723_1176302729 6 Left 1176302723 21:5106232-5106254 CCCACCAGGCAGAGGCGGGAGCC No data
Right 1176302729 21:5106261-5106283 GCCAGAGCGCCTGATAGCCCTGG No data
1176302723_1176302735 28 Left 1176302723 21:5106232-5106254 CCCACCAGGCAGAGGCGGGAGCC No data
Right 1176302735 21:5106283-5106305 GACTGCCACCACCACAGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176302723 Original CRISPR GGCTCCCGCCTCTGCCTGGT GGG (reversed) Intergenic
No off target data available for this crispr