ID: 1176304476

View in Genome Browser
Species Human (GRCh38)
Location 21:5115965-5115987
Sequence CAGTGGGTGGGGAGGGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176304465_1176304476 14 Left 1176304465 21:5115928-5115950 CCTCTCAAGGCGGTAGAATGAAT No data
Right 1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG No data
1176304458_1176304476 24 Left 1176304458 21:5115918-5115940 CCCCCCACGCCCTCTCAAGGCGG No data
Right 1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG No data
1176304463_1176304476 20 Left 1176304463 21:5115922-5115944 CCACGCCCTCTCAAGGCGGTAGA No data
Right 1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG No data
1176304460_1176304476 23 Left 1176304460 21:5115919-5115941 CCCCCACGCCCTCTCAAGGCGGT No data
Right 1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG No data
1176304464_1176304476 15 Left 1176304464 21:5115927-5115949 CCCTCTCAAGGCGGTAGAATGAA No data
Right 1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG No data
1176304468_1176304476 -9 Left 1176304468 21:5115951-5115973 CCGCTGATTCCATGCAGTGGGTG No data
Right 1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG No data
1176304462_1176304476 21 Left 1176304462 21:5115921-5115943 CCCACGCCCTCTCAAGGCGGTAG No data
Right 1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG No data
1176304461_1176304476 22 Left 1176304461 21:5115920-5115942 CCCCACGCCCTCTCAAGGCGGTA No data
Right 1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176304476 Original CRISPR CAGTGGGTGGGGAGGGCCGA GGG Intergenic
No off target data available for this crispr