ID: 1176310237

View in Genome Browser
Species Human (GRCh38)
Location 21:5145453-5145475
Sequence GTGTCCCGCGTCTGGGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176310237_1176310250 24 Left 1176310237 21:5145453-5145475 CCCACAGCCCAGACGCGGGACAC 0: 2
1: 0
2: 0
3: 5
4: 91
Right 1176310250 21:5145500-5145522 CAGGGCTCCAGGCACAGCTAAGG 0: 2
1: 0
2: 3
3: 43
4: 328
1176310237_1176310248 13 Left 1176310237 21:5145453-5145475 CCCACAGCCCAGACGCGGGACAC 0: 2
1: 0
2: 0
3: 5
4: 91
Right 1176310248 21:5145489-5145511 AGCATCTCTGCCAGGGCTCCAGG 0: 2
1: 0
2: 2
3: 53
4: 311
1176310237_1176310247 6 Left 1176310237 21:5145453-5145475 CCCACAGCCCAGACGCGGGACAC 0: 2
1: 0
2: 0
3: 5
4: 91
Right 1176310247 21:5145482-5145504 TCAGGGCAGCATCTCTGCCAGGG 0: 2
1: 0
2: 3
3: 24
4: 270
1176310237_1176310246 5 Left 1176310237 21:5145453-5145475 CCCACAGCCCAGACGCGGGACAC 0: 2
1: 0
2: 0
3: 5
4: 91
Right 1176310246 21:5145481-5145503 ATCAGGGCAGCATCTCTGCCAGG 0: 2
1: 0
2: 3
3: 27
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176310237 Original CRISPR GTGTCCCGCGTCTGGGCTGT GGG (reversed) Intronic
900298639 1:1965575-1965597 GGGTCCTGGCTCTGGGCTGTGGG + Intronic
901053076 1:6435399-6435421 GGGTCGCCCGTGTGGGCTGTGGG - Intronic
901844785 1:11974966-11974988 GTGTTCCGCCTCTGGCCTGCAGG - Exonic
902481165 1:16712650-16712672 GGGTCCCCCGTGTGGGCTGTGGG + Intergenic
904576712 1:31509557-31509579 GTGTGCAGCCTCAGGGCTGTAGG + Intergenic
924732605 1:246725366-246725388 CTGTCCCGAGTCTGGGGTGCAGG + Intronic
1062810461 10:459627-459649 GTGTCCTTCATCTGGGCTCTAGG + Intronic
1062854967 10:775484-775506 GTGTCCAGCGTGAGGGCTGGTGG + Intergenic
1063929691 10:11017555-11017577 GCCTCCCGCGGCTGGGCTCTGGG + Intronic
1064397027 10:14990437-14990459 GTGTACAGCCTCTGGGATGTTGG - Intergenic
1071814579 10:89219745-89219767 CTTTCCCTCCTCTGGGCTGTTGG - Intronic
1075999932 10:126905990-126906012 GCGTCCCGCGTCCGGGCTCTGGG + Intronic
1084062587 11:66685950-66685972 GTGTCACCCGTCGGGGCTGAGGG - Exonic
1084480117 11:69415165-69415187 GTGCCCTGGGTCAGGGCTGTGGG + Intergenic
1092432187 12:8418664-8418686 GTGTACAGCCTCTGGGATGTTGG - Intergenic
1096686706 12:53292850-53292872 CTGTCCTGCGGCTGAGCTGTCGG + Exonic
1113864790 13:113513961-113513983 CTCTGCAGCGTCTGGGCTGTGGG - Intronic
1117008620 14:51447633-51447655 GTGCCCAGAGTGTGGGCTGTAGG - Intergenic
1121863758 14:97343120-97343142 GTGGGCAGCATCTGGGCTGTTGG + Intergenic
1122690666 14:103530785-103530807 GAGTCCAGGGCCTGGGCTGTGGG + Intronic
1125688025 15:41575187-41575209 GTGCCCTGAGCCTGGGCTGTGGG + Intronic
1127058895 15:55161906-55161928 CTGTCCCCTGTCTGTGCTGTTGG + Intergenic
1129343588 15:74902448-74902470 GAGGCCCCCATCTGGGCTGTGGG - Exonic
1132056035 15:98650356-98650378 GCGTCCCGGGGCTGGGCGGTGGG + Intronic
1132087905 15:98923016-98923038 GTGACCAGAGTCTGGGGTGTGGG + Intronic
1132282903 15:100635560-100635582 CTGTCCCGTGTCTTGGCTTTGGG + Intronic
1132555423 16:569981-570003 GGGTCCCGCGGCGGGGCTGGAGG + Intronic
1132729639 16:1355086-1355108 GTCTCCCGCGTCTGCGGGGTCGG + Intronic
1132729658 16:1355150-1355172 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1132729666 16:1355182-1355204 GTCTCCCGCGTCTGTGGGGTCGG + Intronic
1137645102 16:50066579-50066601 CTCCCCCGCGTCTGGGCTGCGGG + Intronic
1143425379 17:6831916-6831938 GTGCCCCGCGTCTTCGCGGTAGG - Intergenic
1146206030 17:30906351-30906373 GTCGTCCGCGTCTGGGCTGCGGG + Exonic
1148467207 17:47872422-47872444 GTTCCCTGCGTCTGGGCCGTGGG + Intergenic
1148688167 17:49512389-49512411 GTGTCCCGGAGCTGGGCTATGGG - Intronic
1151879421 17:76886227-76886249 GTGTGCAGAGTCTGGGCTGGAGG + Intronic
1164835018 19:31350561-31350583 GTGTCCCGCGCCCGGCCTGCCGG + Intergenic
1166719124 19:44987488-44987510 GTGTGCCAGGCCTGGGCTGTGGG + Intronic
1168255363 19:55161776-55161798 GTATTCCGCTTCTGGGCTGGCGG - Exonic
1168398231 19:56066725-56066747 GGGTCCCGCCTGTGGGCTGTAGG + Intergenic
1168706790 19:58474939-58474961 GTCTCCCGTCTCTGGGCTGCTGG - Intronic
1202715200 1_KI270714v1_random:38554-38576 GGGTCCCCCGTGTGGGCTGTGGG + Intergenic
925251164 2:2440252-2440274 CTGTCCCCCGACTGAGCTGTGGG + Intergenic
927701833 2:25274056-25274078 GTGCCTGGAGTCTGGGCTGTAGG - Intronic
936722077 2:115264316-115264338 GTGTCCCTGCTTTGGGCTGTAGG + Intronic
938708178 2:133952061-133952083 GGGTCCAGCATCTGGGATGTTGG - Intergenic
940869698 2:158849618-158849640 GTGTACAGCCTCTGGGATGTTGG + Intronic
943033845 2:182716348-182716370 GTGCGCCGCGGCTGGGCCGTCGG + Exonic
948601815 2:239111750-239111772 GTCTCCCGCCCCTGGGCTGCAGG + Intronic
948612824 2:239180611-239180633 CTGTCCCTTGTCTGGGCTGGGGG - Intronic
1168752994 20:297197-297219 CCGTCCCGCCTGTGGGCTGTGGG + Exonic
1172271274 20:33657052-33657074 GTCTCGCAGGTCTGGGCTGTGGG - Intergenic
1174498653 20:50967808-50967830 GTGTCCCCTGTGTGGTCTGTGGG - Intergenic
1174635990 20:52000055-52000077 CTGTCCCACTTCTTGGCTGTCGG - Intergenic
1175225645 20:57442389-57442411 GTATCCCGCGCCCTGGCTGTTGG - Intergenic
1175606647 20:60316868-60316890 GTGTTCCGCCTCTGGGGCGTTGG + Intergenic
1175974019 20:62701438-62701460 GCGTCCCGGGTCAGGGCTGGTGG - Intergenic
1176310237 21:5145453-5145475 GTGTCCCGCGTCTGGGCTGTGGG - Intronic
1177932648 21:27303890-27303912 GTGTCTCACTTCTGGGCTGCAGG + Intergenic
1178024978 21:28456147-28456169 GTGTCCAGTGTCTAGTCTGTTGG - Intergenic
1179671792 21:42954505-42954527 GTGTACTGCCTCTGGGCTATTGG - Intergenic
1179846818 21:44116582-44116604 GTGTCCCGCGTCTGGGCTGTGGG + Intronic
1180100445 21:45581515-45581537 GTGCCCCACGGCTGGGCTGATGG + Intergenic
1180844101 22:18972162-18972184 GTGCCCAGGGTCTGGCCTGTTGG - Intergenic
1181057369 22:20266549-20266571 GTGCCCAGGGTCTGGCCTGTTGG + Intronic
1181595131 22:23909187-23909209 CTGTCACGCGTCTGTCCTGTTGG + Intergenic
1185055885 22:48578008-48578030 GTGTCGCGTGTCAGGACTGTGGG + Intronic
1185089729 22:48759055-48759077 GTGTCCCGCCTGTGGCCTGGAGG - Intronic
1185190614 22:49433692-49433714 GTGTCCCGCACCTGGGGTCTTGG + Intronic
953460277 3:43076445-43076467 GTGTGCCACGTCTGGGCAGGGGG - Intergenic
956142998 3:66164515-66164537 GTATCCCAAGTCTGGCCTGTAGG - Intronic
965615908 3:170592258-170592280 GTTTACCCTGTCTGGGCTGTAGG + Intronic
967318145 3:188169795-188169817 GAGTACCCCTTCTGGGCTGTGGG - Intronic
970555969 4:17232725-17232747 GTGTTCCTCCTCTGGTCTGTAGG + Intergenic
971729596 4:30360827-30360849 GTGTTCCGTCTCTGGGGTGTTGG + Intergenic
983940730 4:173531899-173531921 GTTTGCCGCGGCTGGGCGGTAGG + Intergenic
985712321 5:1436258-1436280 GTTTCCTGCGTCTGGGCCTTCGG - Intronic
985923332 5:2996552-2996574 GTGTCAAGCGCCGGGGCTGTGGG - Intergenic
989475514 5:41869614-41869636 CTGGCCCGCGCCTGGGCTGCAGG - Intronic
990608090 5:57430084-57430106 CTGTCCCTAGTCTGGGCTGGGGG - Intergenic
997527678 5:134563890-134563912 GTGCCCTGCCTCTGGGCTGTGGG + Intronic
997737098 5:136221405-136221427 TTGGGCCGGGTCTGGGCTGTGGG - Intronic
1002164184 5:177334433-177334455 GTGCCCTGCGGCTGGCCTGTAGG - Intronic
1018102989 6:160457746-160457768 GGCTCCCGCCTATGGGCTGTCGG - Intergenic
1020256675 7:6506336-6506358 GTGTCCAGCGTCTGGCCCCTAGG - Intronic
1024741842 7:52363025-52363047 GGGTCCCGCACCTGGGCTGCAGG - Intergenic
1030227465 7:107169150-107169172 GCGGCCCGCGCCTGGGCTGCCGG + Exonic
1034215854 7:149405067-149405089 GTGATACGCGTCTGGACTGTGGG - Intergenic
1034951013 7:155297427-155297449 GTGTCCCGCGCCTGGCCGGGAGG - Intergenic
1035492960 7:159295961-159295983 GTGTTCCTGGTCTGGGCTCTAGG + Intergenic
1036905814 8:12707664-12707686 GTGTACAGCCTCTGGGATGTTGG - Intergenic
1041511530 8:58659424-58659446 GTGTCCAGGGCCTGGGCTGGGGG - Exonic
1046444954 8:114306404-114306426 GTGTACCCAGTCTGGTCTGTGGG - Intergenic
1052935258 9:34087583-34087605 GTGTCCCCCGTGTGGGAAGTTGG - Exonic
1052974084 9:34399108-34399130 GTGTCCAGAGAGTGGGCTGTGGG + Exonic
1056866036 9:90228076-90228098 GTGTACAGCTTCTGGGATGTTGG + Intergenic
1058504655 9:105655831-105655853 GTTTCCTGGGTCTGGGTTGTGGG + Intergenic
1062357944 9:136173881-136173903 GCGTGCCGGGCCTGGGCTGTGGG - Intergenic