ID: 1176312794

View in Genome Browser
Species Human (GRCh38)
Location 21:5162461-5162483
Sequence ATTTCAATACAGATAGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 6, 1: 2, 2: 0, 3: 28, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176312786_1176312794 25 Left 1176312786 21:5162413-5162435 CCACACTGGATTTCACTACAGAG 0: 10
1: 0
2: 6
3: 7
4: 107
Right 1176312794 21:5162461-5162483 ATTTCAATACAGATAGAACCAGG 0: 6
1: 2
2: 0
3: 28
4: 212
1176312790_1176312794 -2 Left 1176312790 21:5162440-5162462 CCAGGCTGCAGACCCCACTGGAT 0: 18
1: 2
2: 2
3: 23
4: 212
Right 1176312794 21:5162461-5162483 ATTTCAATACAGATAGAACCAGG 0: 6
1: 2
2: 0
3: 28
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176312794 Original CRISPR ATTTCAATACAGATAGAACC AGG Intergenic
903591468 1:24459110-24459132 ATTTCCAGACAGAGAGACCCGGG + Intronic
903858864 1:26353435-26353457 ATTTCAACACAAATAAAACTAGG + Intronic
905586719 1:39125654-39125676 ATTTAAAAACAGACAGGACCTGG - Intronic
907093717 1:51754386-51754408 ATTTCAATACAATTAAAATCAGG + Intronic
907954096 1:59212206-59212228 ATTTCGAGACAGAAAGAGCCTGG - Intergenic
908519681 1:64929464-64929486 AATTAAATCCAGATGGAACCTGG + Intronic
911064606 1:93777019-93777041 ATTTGAACACAGATAGACACAGG + Intronic
914424084 1:147558586-147558608 ATGTCTCCACAGATAGAACCAGG - Intronic
916047745 1:161013430-161013452 ACTGCAATACAATTAGAACCTGG + Intronic
916769782 1:167896993-167897015 ATTTTAATTCAAATAAAACCTGG + Intronic
917830792 1:178883467-178883489 CTTTCATTAAAGATAGAACCAGG + Exonic
918125741 1:181581900-181581922 AGTTTTATACAGATAGAATCAGG - Intronic
918351939 1:183665510-183665532 ATTCCAAAACATATAGCACCAGG - Intronic
918837582 1:189487687-189487709 ATTTCAATACAGATATGATAGGG - Intergenic
919074903 1:192801143-192801165 ATGTTAATACAGATAGAAAGTGG - Intergenic
920189435 1:204183291-204183313 TTTTCAATACTGAAACAACCAGG - Intergenic
922057974 1:222059496-222059518 TTTTAGATACAGATAGACCCTGG - Intergenic
922521865 1:226260198-226260220 CTTCCAAAACAGATAGCACCAGG + Intronic
923187034 1:231584444-231584466 ATTTAAAAACAGATAGATACAGG - Intronic
923419974 1:233803415-233803437 ATTTCAAAACAGAAAACACCAGG + Intergenic
924364743 1:243280027-243280049 CTTTCAAAACAGAAAGCACCAGG - Intronic
1063559429 10:7112641-7112663 ATTTCAATACACACAGAATGAGG - Intergenic
1065873159 10:29973416-29973438 ATAGCAAAACAAATAGAACCAGG + Intergenic
1066043088 10:31571134-31571156 ATTCCAAAACAGAAAGCACCAGG + Intergenic
1069253454 10:66301188-66301210 CTTCCAAAACAGAAAGAACCAGG + Intronic
1069457772 10:68567363-68567385 ATTTTTAAACAGATTGAACCCGG + Intronic
1072053070 10:91725572-91725594 ATTACAATGCAGATCTAACCTGG - Intergenic
1073608389 10:104918896-104918918 ATTCCAAAACAGATACAAACAGG - Intronic
1079613316 11:22460068-22460090 ATTTGAAGCCAGATACAACCAGG - Intergenic
1079898696 11:26153865-26153887 ATTTCAAAACAGCTAGAAGTGGG + Intergenic
1081034488 11:38125144-38125166 ATTTCACTAGAGTTAGAAGCAGG - Intergenic
1081419790 11:42862215-42862237 AATTACATACAGATAGGACCAGG + Intergenic
1081510333 11:43765790-43765812 ATTTTAATACAGAGAGAAAAAGG - Intronic
1082761488 11:57131073-57131095 ATTTCAATACAGAAAGTCACAGG - Intergenic
1083093633 11:60226162-60226184 TTTTCAAAACAGAAAGCACCAGG + Intronic
1088526113 11:110756930-110756952 ATTTTAATCCAGTTAGAAACTGG + Intergenic
1089229410 11:116958670-116958692 ATTTCACTACAGAGAGAACTGGG + Intronic
1090502661 11:127276596-127276618 ATTCCCATTCAGAAAGAACCTGG + Intergenic
1090513633 11:127401319-127401341 ATTTCAATATAGATAAATCTGGG + Intergenic
1090514379 11:127410356-127410378 ATTTTATTTCAGAGAGAACCAGG - Intergenic
1090821043 11:130341956-130341978 ATTTCAATACTGAGAGTATCAGG - Intergenic
1090841554 11:130493115-130493137 CTTTCAAAACAGAAAGAACCAGG - Intergenic
1091816377 12:3441885-3441907 ATTTCAGTACATTTAGAAACAGG + Intronic
1092095057 12:5834845-5834867 CTTTCCATATAGATAGAACTAGG + Intronic
1094073215 12:26442597-26442619 ATTTCTATACAAATAGAAATAGG - Intronic
1095881987 12:47147631-47147653 ATATCAATAGAAATAGAACATGG - Intronic
1097371401 12:58785802-58785824 ATCTCAATATTGAGAGAACCCGG - Intronic
1098457898 12:70696449-70696471 ATTCCAATCCAGATGAAACCAGG - Intronic
1098627160 12:72686014-72686036 GTTTGAATACAGAGAGAACAGGG + Intergenic
1100810964 12:98337869-98337891 AATTCAATACAGAAACACCCAGG + Intergenic
1100974681 12:100110267-100110289 ATATGAATTCAGATAGAATCTGG - Intronic
1108338923 13:49476894-49476916 ATTTCATTACAGAAAGAAATGGG - Exonic
1108801419 13:54100803-54100825 ATTAATATACAGATAAAACCAGG + Intergenic
1114057383 14:18984029-18984051 ATCTAAATGCAGATAGGACCAGG + Intronic
1114105163 14:19417718-19417740 ATCTAAATGCAGATAGGACCAGG - Intronic
1115878237 14:37885472-37885494 CTTTCAACACAGAGAGCACCAGG - Intronic
1116755149 14:48939172-48939194 ATTTCTATAGAGGTAGAAACAGG + Intergenic
1119149974 14:72349833-72349855 AATTCAATTCAGGTAGACCCCGG - Intronic
1122369302 14:101220234-101220256 ATCTCAATTCAGAAAGACCCTGG + Intergenic
1123498075 15:20850391-20850413 ATCTTAATACAGATAGGACCAGG - Intronic
1123555306 15:21424019-21424041 ATCTTAATACAGATAGGACCAGG - Intronic
1123591551 15:21861350-21861372 ATCTTAATACAGATAGGACCAGG - Intergenic
1125284593 15:38078690-38078712 ATTTCACTTCACACAGAACCAGG + Intergenic
1126687723 15:51262988-51263010 ATTTCAAGAAAGATTAAACCAGG + Intronic
1127107594 15:55633518-55633540 ATTTTAATACAAATGGAACAAGG - Intronic
1127422122 15:58816640-58816662 ATCACTATACAGATAGAACTAGG + Intronic
1127549030 15:60018674-60018696 ATTTAAAGACAGGTAGAATCTGG - Intronic
1128394743 15:67212800-67212822 ATTTTAATAAACATTGAACCAGG - Intronic
1202963652 15_KI270727v1_random:151228-151250 ATCTTAATACAGATAGGACCAGG - Intergenic
1137989093 16:53133683-53133705 ATATGAATACAGATAGAAAACGG + Intronic
1139459620 16:67111113-67111135 ATTTCAAAAGAGAGAGAAGCGGG - Intronic
1141792329 16:86245121-86245143 ATTTCAATACACATAGCAGCTGG + Intergenic
1143565854 17:7720101-7720123 ATTTTAAGACAGAAAGAACAAGG - Intronic
1146670614 17:34734922-34734944 ACTTCAATAGAGATGGCACCAGG + Intergenic
1148197209 17:45722599-45722621 ATTTCAACACATATAGAACTTGG - Intergenic
1148778767 17:50110209-50110231 ACTTCCATAGAGACAGAACCTGG - Exonic
1149103458 17:52933735-52933757 ATCTCAAGAGAGAAAGAACCAGG + Intergenic
1149515579 17:57278491-57278513 TTTTAAATTCAGATAGTACCAGG - Intronic
1149927134 17:60712548-60712570 ATTTGAATTCAGACAGAACTAGG - Intronic
1150214340 17:63458225-63458247 ATTTCACTAGAGGCAGAACCAGG + Intergenic
1150266130 17:63833499-63833521 ATTTCCATACATGTAGCACCTGG - Intronic
1152274415 17:79347807-79347829 ATTTCTATTCTGATAGAATCTGG + Intronic
1153184940 18:2475514-2475536 ATCTCACTACCTATAGAACCAGG - Intergenic
1153942843 18:9992152-9992174 ATTTCAAGACAGAAAGACCTAGG - Intergenic
1154456075 18:14526820-14526842 ATCTAAATACAGATAGGACCAGG - Intronic
1155081234 18:22412000-22412022 ATTTCAATATAGAAAAGACCAGG - Intergenic
1155559212 18:27057668-27057690 ATATCGATACAGATAGATCTGGG + Intronic
1155640105 18:28003334-28003356 ATTTCAAAAAAGATAAAACCTGG + Intronic
1156515122 18:37672778-37672800 TTTTGAAAACAGATAGATCCAGG - Intergenic
1158645050 18:59238414-59238436 ATTGCTATATTGATAGAACCAGG - Intergenic
1159497410 18:69224150-69224172 ATTTTAACACAGAGATAACCAGG + Intergenic
1164720419 19:30427890-30427912 ATTATATTACAGATTGAACCTGG - Intronic
925233869 2:2260125-2260147 ATTACATTACAGAGAGAAACAGG + Intronic
925447699 2:3942076-3942098 ATTTCAAAACAGAGAGAAATGGG - Intergenic
925937719 2:8782537-8782559 TTTTCAAAACAGAAAGCACCAGG + Intronic
927037727 2:19197559-19197581 ATTTCAAAACAGAAAACACCAGG + Intergenic
928695321 2:33843122-33843144 AGTTTAATACATATAGCACCAGG + Intergenic
930338122 2:50076424-50076446 ATTTCAAAACAGTTAGAAATTGG - Intronic
932712090 2:74073848-74073870 ATTTCAAGACAGAGAGAAGCAGG - Intronic
932768461 2:74486320-74486342 ATTCCAATAGAGACAGAGCCAGG - Intronic
932894782 2:75629130-75629152 TTATCAATACTGATAGAATCAGG + Intergenic
933896580 2:86815834-86815856 AATTCAACACAGAAAGAGCCAGG + Intronic
935748132 2:106207319-106207341 ATTTCTCTACAGATAGATTCTGG - Intergenic
936069985 2:109361438-109361460 CTTTCAAAACAGAAAGAACCAGG - Intronic
938283764 2:130089495-130089517 ATCTAAATGCAGATAGGACCCGG - Intronic
938334412 2:130478061-130478083 ATCTAAATGCAGATAGGACCCGG - Intronic
938355412 2:130642607-130642629 ATCTAAATGCAGATAGGACCCGG + Intronic
938431843 2:131249398-131249420 ATCTAAATGCAGATAGGACCCGG + Intronic
939569929 2:143829162-143829184 ATTTCCATACAGATGGAAAAGGG + Intergenic
939632242 2:144538785-144538807 ATTTTAATAAAGATGGAGCCAGG + Intergenic
939664066 2:144928809-144928831 AGTTCAATACAGATTTAAGCAGG - Intergenic
939841907 2:147199336-147199358 ATCTGAATACAATTAGAACCTGG + Intergenic
941189468 2:162360793-162360815 ATTTCACTACAGATTGAACTAGG - Exonic
941402793 2:165051915-165051937 CTTTCAAAATAGAAAGAACCAGG + Intergenic
942482981 2:176409007-176409029 GTTTCAATACAGATAAAAAGGGG - Intergenic
943246858 2:185465072-185465094 TTTTCAAAACAGAAAGAACCAGG + Intergenic
944782230 2:203031125-203031147 ATTTCAAAACAATGAGAACCTGG - Intronic
945706793 2:213245183-213245205 ACTTGAGTACAGATAGAAACAGG + Intergenic
945882331 2:215339221-215339243 ATATCAATACATATAGATGCTGG + Intronic
946059295 2:216927853-216927875 ATTTCAATGAAGACAGACCCTGG - Intergenic
946623322 2:221582854-221582876 ATTTCAATACAAAGTGTACCCGG + Intergenic
946808237 2:223494053-223494075 ATTTCCATGCAAATAGAAACAGG - Intergenic
1168888594 20:1278365-1278387 ATTTCAATAAAGCTAGAAGGAGG - Intronic
1174058542 20:47816313-47816335 ATTTCTATACATATTGAGCCAGG - Intergenic
1174875003 20:54217753-54217775 ATTTCTATACCGAGAAAACCTGG - Intronic
1176312751 21:5162188-5162210 ATTTCACTACAGAGTGAACCAGG + Intergenic
1176312757 21:5162227-5162249 ATTTCAATACAGATAGAACCAGG + Intergenic
1176312764 21:5162266-5162288 ATTTCACTACAGAGTGGACCAGG + Intergenic
1176312770 21:5162305-5162327 ATTTCAATACAGCTAGAACCAGG + Intergenic
1176312777 21:5162344-5162366 ATTTCACTACAGAGTGGACCAGG + Intergenic
1176312783 21:5162383-5162405 ATTTCAATACAGATAGAACCAGG + Intergenic
1176312788 21:5162422-5162444 ATTTCACTACAGAGTGGACCAGG + Intergenic
1176312794 21:5162461-5162483 ATTTCAATACAGATAGAACCAGG + Intergenic
1176312800 21:5162500-5162522 ATTTCACTACAGAGTGAACCAGG + Intergenic
1176818087 21:13626520-13626542 ATCTAAATACAGATAGGACCAGG + Intronic
1176991217 21:15498517-15498539 ATTTGAATACAAATAGAAATTGG - Intergenic
1177352050 21:19955908-19955930 ATTTCAAAATAGTTAGAACAGGG - Intergenic
1177495260 21:21880857-21880879 AGTTAAATCCAGATATAACCTGG + Intergenic
1179844248 21:44099530-44099552 ATTTCACTACAGAGTGAACCAGG - Intronic
1179844254 21:44099569-44099591 ATTTCAATACAGATAGAACCAGG - Intronic
1179844260 21:44099608-44099630 ATTTCACTACAGAGTGGACCAGG - Intronic
1179844265 21:44099647-44099669 ATTTCAATACAGATAGAACCAGG - Intronic
1179844271 21:44099686-44099708 ATTTCACTACAGAGTGGACCAGG - Intronic
1179844278 21:44099725-44099747 ATTTCAATACAGCTAGAACCAGG - Intronic
1179844284 21:44099764-44099786 ATTTCACTACAGAGTGGACCAGG - Intronic
1179844291 21:44099803-44099825 ATTTCAATACAGATAGAACCAGG - Intronic
1179844297 21:44099842-44099864 ATTTCACTACAGAGTGAACCAGG - Intronic
1180475872 22:15706638-15706660 ATCTAAATGCAGATAGGACCAGG + Intronic
950289136 3:11769566-11769588 ATTTCATTTAAGAAAGAACCCGG + Intergenic
951158808 3:19389924-19389946 GTTTTAATACAGATACAAGCCGG - Intronic
951428839 3:22582824-22582846 ATTTCAAAAAAGATAAGACCAGG + Intergenic
951546106 3:23827121-23827143 ATTTCAATGCAGACATAACATGG + Intronic
952049924 3:29372395-29372417 ATTATAAAACAAATAGAACCCGG - Intronic
952735411 3:36686184-36686206 CTTCCAAAACAGAAAGAACCAGG + Intergenic
954495370 3:50954354-50954376 ATAACAATACAGAAAGAACCAGG + Intronic
955511387 3:59683918-59683940 ATTTAACTACAGATAGGATCTGG + Intergenic
958443788 3:94190126-94190148 CTTCCAACACAGATAGCACCTGG - Intergenic
958684128 3:97371022-97371044 AATTCAGTGCAGATAGGACCAGG - Intronic
960390711 3:117074342-117074364 AGCTCAATAAAGATAGAACAGGG + Intronic
963014878 3:140813312-140813334 CTTTCAAAACAGAAAGTACCAGG + Intergenic
963178996 3:142333844-142333866 ATTGAAATACAGTTAGAATCCGG - Intronic
963402856 3:144823365-144823387 TTTTCAAACCAGATAGAACATGG - Intergenic
963574030 3:147036942-147036964 GTTTCAAAACAGAAAGCACCAGG + Intergenic
965147936 3:164930004-164930026 ATTTTTCTACAGATAGAACTTGG + Intergenic
967863503 3:194171348-194171370 ATTTCAATGCAGTTTGACCCAGG + Intergenic
969920891 4:10538729-10538751 ATTTCAGTACCCATATAACCTGG - Intronic
970226878 4:13868060-13868082 TTTTCAAGTCAGATAGAACTGGG - Intergenic
970346936 4:15161535-15161557 ATTTCAATTCAGAGAGAGCAGGG + Intergenic
972916043 4:43881024-43881046 ATTAGAATGTAGATAGAACCTGG - Intergenic
973779808 4:54277621-54277643 ATCTAAATACACATAAAACCTGG - Intronic
974589335 4:63922485-63922507 ATTTCAAGGCAGACAGAAACAGG - Intergenic
975054116 4:69906426-69906448 ATTTGAATCCAGATAGCCCCAGG - Intergenic
975648262 4:76566738-76566760 ATCTCAAGTCAGATGGAACCAGG - Intronic
976988776 4:91337477-91337499 ATATCAATATGGAAAGAACCAGG - Intronic
979940478 4:126756383-126756405 ATATCAATACCAATAGAAACTGG - Intergenic
979958607 4:126988626-126988648 ATTTAAATTTAGATAGAACCAGG + Intergenic
981261437 4:142724638-142724660 ATTTCAGTATAGATAAAACTTGG + Intronic
981555944 4:145993969-145993991 TTTGCAATACAGAAAGCACCAGG - Intergenic
981681154 4:147399781-147399803 ATTTCATTACAGCCAGAACTAGG - Intergenic
983307310 4:166007225-166007247 ACTACAATACAGATACAAACAGG + Intronic
983725968 4:170926306-170926328 ATTTATATACATATAGAACAAGG + Intergenic
988598187 5:32614631-32614653 ATTTCAAAACAAAAAGAACTTGG - Intergenic
989563174 5:42874177-42874199 ATTTCAATGAAGACAGCACCTGG - Intronic
990549215 5:56856223-56856245 AAGTCAATACAGATAGAATCTGG - Intronic
990996284 5:61735281-61735303 ATTTCAATATAAATAAAACATGG + Intronic
991345655 5:65664068-65664090 ATGTCACTTAAGATAGAACCAGG - Intronic
993807775 5:92434449-92434471 CTTTCAATATTGATAAAACCAGG + Intergenic
994346978 5:98698237-98698259 TTTTCAATAAAGAAAGAATCAGG - Intergenic
995091331 5:108181231-108181253 ATTTCAATAAACTTAGAATCAGG + Intronic
995901540 5:117073453-117073475 ATTCCAATAAAGATTGAAACAGG - Intergenic
996302914 5:122009206-122009228 ATTTAAAAAAAGATAAAACCAGG - Intronic
998535629 5:142928279-142928301 ATTTTAAGACAGATAAAACATGG + Intronic
998807506 5:145933352-145933374 ATAACTATACAGATAGAAACAGG + Intergenic
998897945 5:146820173-146820195 ATTTCAAAACATCTAGAAGCAGG + Intronic
999045362 5:148462530-148462552 CTTTCAAAACAGAAAGTACCAGG + Intronic
999580047 5:153028306-153028328 CTTTCAAAACAGAAAGCACCAGG + Intergenic
1008171239 6:48209461-48209483 ATATCAATACAGACATAATCAGG - Intergenic
1009043442 6:58209838-58209860 ATTTCAAACCAGATACATCCAGG - Intergenic
1009219276 6:60964100-60964122 ATTTCAAACCAGATATATCCAGG - Intergenic
1009316981 6:62231981-62232003 ATTTCAAAACATATTAAACCAGG - Intronic
1009662961 6:66637049-66637071 ATTTCAATACCATTAGTACCAGG - Intergenic
1013606406 6:111753045-111753067 ATTTCAATATATATAGAAATGGG - Intronic
1014654710 6:124086795-124086817 CTTTCAAAACAGAAAGCACCAGG + Intronic
1015230230 6:130906793-130906815 ATTTTAATACAGAAAGAAAGAGG + Intronic
1016970666 6:149759209-149759231 TTTTCAGTACAGAAAGTACCTGG + Intronic
1019013266 6:168860492-168860514 ATTTAAACACAGTTTGAACCGGG - Intergenic
1019830021 7:3318920-3318942 ATTTGGATACAGATGGTACCTGG + Intronic
1021497628 7:21293540-21293562 ATTTCAATACAGATTTTACATGG + Intergenic
1021548778 7:21846830-21846852 CTTTCAAAACAGAAAGCACCAGG - Intronic
1022947403 7:35301105-35301127 ACTTCAATAGAGATGGCACCAGG - Intergenic
1023210708 7:37801600-37801622 ATTTCAAAACAGAGAGCACCAGG - Intronic
1023591687 7:41787392-41787414 ATTTCAATACAGTTTAAAGCAGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1026420305 7:70229785-70229807 ATTTCAACACAGATTGATCCAGG - Intronic
1027854371 7:83490071-83490093 ATTTCAGTAGAGATAGAAAAGGG - Intronic
1027856599 7:83519746-83519768 ATTTCTGTACGCATAGAACCTGG + Intronic
1030045164 7:105488837-105488859 TTTTCAACACAGAAAGAACTAGG - Intronic
1030219886 7:107087381-107087403 ACTTTAATATAAATAGAACCTGG + Intronic
1031817618 7:126458251-126458273 ATTTAAATACAGATATTATCAGG + Intronic
1032099224 7:128959368-128959390 TTTTCAGAACAGATAGAAACAGG + Intronic
1036387792 8:8296888-8296910 ATTTCAAATCAGAAAGAAACTGG - Intergenic
1036960603 8:13240880-13240902 AGTTTAATACACATAGCACCAGG - Intronic
1037181017 8:16005717-16005739 GTTTCAATCCACAGAGAACCCGG + Intergenic
1040352996 8:46587291-46587313 ATTTCTAGATAGATACAACCAGG - Intergenic
1040681359 8:49813754-49813776 ATTTTAATATAGACAGCACCTGG + Intergenic
1041760666 8:61362737-61362759 TTTGCAATTCAGATAGAATCAGG - Intronic
1042117322 8:65446367-65446389 ACTTTAAAACAGTTAGAACCAGG + Intergenic
1042399132 8:68326127-68326149 TTTTCCACACAGTTAGAACCAGG + Intronic
1042518338 8:69683388-69683410 ATTTCAAAAAAGATAAGACCTGG - Intronic
1045624707 8:104030189-104030211 ATTAAAATACACATAGAGCCTGG + Intronic
1045932380 8:107642428-107642450 ATTGCAGTAAAGATTGAACCAGG + Intergenic
1047549029 8:125849858-125849880 ATTTTTATACATATAGAATCAGG + Intergenic
1051489005 9:17639985-17640007 ATTTGACTACAGAAAGTACCAGG + Intronic
1053263114 9:36688630-36688652 ATTTGAATAAAGATATATCCTGG + Intergenic
1053653404 9:40191849-40191871 ATATCACTAGAGATAGAAGCAGG - Intergenic
1053903806 9:42821139-42821161 ATATCACTAGAGATAGAAGCAGG - Intergenic
1054531180 9:66184369-66184391 ATATCACTAGAGATAGAAGCAGG + Intergenic
1059737633 9:117118111-117118133 ATGACAACACTGATAGAACCAGG - Intronic
1061633562 9:131890275-131890297 ATTGCAAGACCGAGAGAACCAGG - Intronic
1203529272 Un_GL000213v1:122984-123006 ATCTAAATACAGATAGGACCAGG - Intergenic
1188165455 X:26857254-26857276 ATTTAAATACAGATATAAGAGGG - Intergenic
1189731379 X:44024632-44024654 ATTTCTATAAAGATAGAATTAGG - Intergenic
1192611720 X:72573307-72573329 ATATAAACACAGATAGAACGTGG + Intergenic
1195603948 X:106780778-106780800 CTTTAAAGCCAGATAGAACCTGG + Intronic
1196403493 X:115340468-115340490 ATTTAACTACTGATAGAGCCTGG + Intergenic
1197432048 X:126378039-126378061 ATTTCAATATTTATAGAACCAGG - Intergenic
1197630787 X:128855289-128855311 ATTTCAAAACAGCTAGAAGACGG + Intergenic
1198157038 X:133971251-133971273 CTTTCTATACAGATAGAACAAGG - Intronic