ID: 1176313120

View in Genome Browser
Species Human (GRCh38)
Location 21:5165169-5165191
Sequence GGCAAATCTGCATTCTTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 2, 1: 0, 2: 3, 3: 19, 4: 212}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176313120_1176313125 11 Left 1176313120 21:5165169-5165191 CCAGCAAAGAATGCAGATTTGCC 0: 2
1: 0
2: 3
3: 19
4: 212
Right 1176313125 21:5165203-5165225 AGGACACCCAGAGTTGCAGTAGG 0: 2
1: 0
2: 1
3: 11
4: 172
1176313120_1176313129 21 Left 1176313120 21:5165169-5165191 CCAGCAAAGAATGCAGATTTGCC 0: 2
1: 0
2: 3
3: 19
4: 212
Right 1176313129 21:5165213-5165235 GAGTTGCAGTAGGACACAGTGGG 0: 2
1: 0
2: 5
3: 12
4: 128
1176313120_1176313123 -9 Left 1176313120 21:5165169-5165191 CCAGCAAAGAATGCAGATTTGCC 0: 2
1: 0
2: 3
3: 19
4: 212
Right 1176313123 21:5165183-5165205 AGATTTGCCTCAGGGCTTGAAGG 0: 2
1: 0
2: 1
3: 16
4: 166
1176313120_1176313130 22 Left 1176313120 21:5165169-5165191 CCAGCAAAGAATGCAGATTTGCC 0: 2
1: 0
2: 3
3: 19
4: 212
Right 1176313130 21:5165214-5165236 AGTTGCAGTAGGACACAGTGGGG 0: 2
1: 0
2: 2
3: 15
4: 183
1176313120_1176313128 20 Left 1176313120 21:5165169-5165191 CCAGCAAAGAATGCAGATTTGCC 0: 2
1: 0
2: 3
3: 19
4: 212
Right 1176313128 21:5165212-5165234 AGAGTTGCAGTAGGACACAGTGG 0: 2
1: 0
2: 1
3: 21
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176313120 Original CRISPR GGCAAATCTGCATTCTTTGC TGG (reversed) Intergenic
900982008 1:6051228-6051250 GGCAAAGCTGCATTCCAGGCAGG - Intronic
901380238 1:8868510-8868532 GGCAAATCTTCATCCTCTGATGG + Intronic
901547167 1:9966882-9966904 GGCACTTCTTCATTGTTTGCTGG - Intronic
902103644 1:14014869-14014891 GGCCAAAATGCATTTTTTGCTGG + Intergenic
902679942 1:18036246-18036268 GGCAAATCTGCATACTTCTCTGG - Intergenic
907897143 1:58702533-58702555 GGCAACTCTGAATTCTGTACAGG - Intergenic
908886105 1:68790825-68790847 GGCAAGGCTGCATTCTTGTCTGG + Intergenic
909294005 1:73922389-73922411 GGCAAATCTGCAATTTTTAGTGG - Intergenic
910387080 1:86696014-86696036 GGCAAATCTGCTTTCTATTTCGG - Intergenic
911136689 1:94448049-94448071 GGCAAATCTAGAGTCTTTTCTGG - Intronic
912982554 1:114389158-114389180 CCAAAATCTGCAGTCTTTGCAGG + Intergenic
920074642 1:203327383-203327405 CACAAGTCTGCTTTCTTTGCTGG + Intergenic
920789814 1:209079183-209079205 GGCAAAACTGTGTTCTTTCCAGG + Intergenic
921616877 1:217279154-217279176 GGCAAATATGCATTTGTTCCTGG + Intergenic
921950649 1:220926574-220926596 GGCAAATCTAACTTCTCTGCTGG + Intergenic
923076401 1:230612823-230612845 GGCAAGTCTCCATTCTCTGCAGG + Intergenic
923978015 1:239286509-239286531 GTCAAATCTCCCTTCTTGGCTGG - Intergenic
1063354280 10:5383245-5383267 GTCAAAGCTGCTTTCTTTGGAGG + Intergenic
1065857176 10:29840040-29840062 GGGCAAGCTGCATTCTTTCCAGG + Intergenic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1066197046 10:33110633-33110655 GGGCAATCTCCATTCTTGGCAGG - Intergenic
1066645576 10:37604808-37604830 GGCAAATCTGCAGTCATAGTTGG + Intergenic
1066762985 10:38774411-38774433 AGCAAATCTTAATTCTATGCTGG - Intergenic
1066958590 10:42198020-42198042 AGCAAATCTCAATTCTATGCTGG + Intergenic
1068521585 10:58083231-58083253 TGGAAATCTCCATTCTTTGAAGG + Intergenic
1068554208 10:58439966-58439988 GGCACAGCTGCATTCCTTTCTGG + Intergenic
1070576376 10:77682065-77682087 GGCATATCTGCAGTCTGTGTAGG - Intergenic
1072738567 10:97895985-97896007 GTGAAATCTGCATTGTTTGTAGG - Exonic
1073887890 10:108062476-108062498 GAAAAATCTGTATTCTTTGTTGG - Intergenic
1074925555 10:118066233-118066255 GGCTAAGCTGCATTCTTATCTGG - Intergenic
1075210273 10:120485072-120485094 AGCAAAGCTGCATTCCTTTCTGG - Intronic
1078471412 11:11589961-11589983 CTCAGATCTGGATTCTTTGCAGG - Intronic
1080233912 11:30046953-30046975 GGCAAAGCTGCATTCATTGATGG + Intergenic
1081521779 11:43888758-43888780 AGCAAATCTTCACTCTTTGAAGG - Intronic
1081641874 11:44761456-44761478 AGCAAATCTGCATTGTGTGAGGG - Intronic
1089587152 11:119517384-119517406 GGCAAATGTTTATTCTTTGAGGG + Intergenic
1093420512 12:18968999-18969021 GGCAAATTTGCTTTCTCTTCTGG + Intergenic
1095445689 12:42279850-42279872 GGCAGAACTGAATTCCTTGCAGG + Intronic
1095474010 12:42566501-42566523 AGAACATCTGCATTCTCTGCTGG + Intronic
1097502015 12:60415704-60415726 GTGAAAACTGCATTCTTTGGAGG - Intergenic
1099964965 12:89436415-89436437 TTCAAATAAGCATTCTTTGCTGG + Intronic
1100984326 12:100189998-100190020 CGCCTATCTGCATTCTCTGCCGG - Intergenic
1104041476 12:125133981-125134003 GGCACCTCTGCTGTCTTTGCAGG + Exonic
1104206676 12:126645226-126645248 GACAAGGCTGCATTCTTTTCTGG - Intergenic
1106100509 13:26691691-26691713 AGAAAATCTGCAGTCTTGGCTGG - Intergenic
1106695237 13:32165842-32165864 GACAAAGCTGCCTTCTTTGTTGG - Intronic
1107067715 13:36233242-36233264 GTAAAATCTGTATTCTTTGTTGG - Intronic
1107890703 13:44911767-44911789 AGCAAATCTGCAATATTTGAGGG - Intergenic
1111445638 13:88343685-88343707 GTAAAATCTGTATTCTTTCCTGG + Intergenic
1111958081 13:94780109-94780131 GGCAGATCTTGAGTCTTTGCAGG + Intergenic
1113467721 13:110524043-110524065 GGCAAAGAGGCAGTCTTTGCTGG + Exonic
1114209328 14:20601893-20601915 GGAAAAGCTGCATTCATTGATGG + Intronic
1115890541 14:38022737-38022759 GGAAAAAATGCATTCTTTTCAGG - Intronic
1117189597 14:53277313-53277335 GGCAAAGCTGCATTTATTGATGG - Intergenic
1118378017 14:65193547-65193569 GGGAAGTCTGCACCCTTTGCAGG - Intergenic
1121302689 14:92884712-92884734 TGCAACTCAGCACTCTTTGCAGG + Intergenic
1121425667 14:93849879-93849901 GGGAGATCTTCATTATTTGCTGG + Intergenic
1121795725 14:96733623-96733645 GGCAAATCTCCATTCTTTACGGG + Intergenic
1125061297 15:35428362-35428384 GGCAAATCTTCATCCTTTAAGGG + Intronic
1125175468 15:36817288-36817310 AGCTATTCTGCATTCTTTTCAGG - Intergenic
1126258107 15:46652098-46652120 TGAAAATCTGCATAATTTGCAGG + Intergenic
1127434314 15:58941675-58941697 GACAAATCTGCAATTTTTGTAGG + Intronic
1128321653 15:66698918-66698940 GGGGGATCTGCCTTCTTTGCTGG - Intergenic
1128607530 15:69047833-69047855 GGCAAGTATGCTTTCTTTTCTGG - Exonic
1129773241 15:78216306-78216328 AACAAAGATGCATTCTTTGCAGG + Intronic
1132981182 16:2739398-2739420 CTCACATCTGCAATCTTTGCAGG + Intergenic
1136711526 16:32240804-32240826 AGCAAGCCTGCTTTCTTTGCAGG - Intergenic
1136811724 16:33181773-33181795 AGCAAGCCTGCTTTCTTTGCAGG - Intergenic
1136818200 16:33291853-33291875 AGCAAGCCTGCTTTCTTTGCAGG - Intronic
1136824764 16:33348381-33348403 AGCAAGCCTGCTTTCTTTGCAGG - Intergenic
1136829830 16:33447152-33447174 AGCAAGCCTGCTTTCTTTGCAGG - Intergenic
1137528414 16:49259420-49259442 GTCACATCTGCATTCTTTCCAGG - Intergenic
1138500313 16:57438093-57438115 TATAAATCAGCATTCTTTGCTGG - Intronic
1138500419 16:57439309-57439331 GTCAAAGCTGGATTCTTTGTGGG + Exonic
1139038509 16:62976642-62976664 GGCAGCTCTGCATACTTTGGTGG - Intergenic
1139068569 16:63350986-63351008 GGCAAATCTGAAATCATTGATGG - Intergenic
1139134804 16:64189364-64189386 GTCAAATCTGAATTCCTTTCTGG - Intergenic
1140144217 16:72289907-72289929 GGTAAATCTGCATTCACTGCTGG - Intergenic
1202990302 16_KI270728v1_random:4741-4763 AGCAAGCCTGCTTTCTTTGCAGG - Intergenic
1203058528 16_KI270728v1_random:948955-948977 AGCAAGCCTGCTTTCTTTGCAGG + Intergenic
1144292575 17:13840853-13840875 GGCAAGAGTGAATTCTTTGCTGG + Intergenic
1144506521 17:15836007-15836029 TGCAAATCAGCATTTATTGCCGG + Intergenic
1144955859 17:19018465-19018487 GGCTCATCTGTTTTCTTTGCTGG + Intronic
1145118569 17:20234822-20234844 TGCAAACCAGCATTCATTGCTGG + Intronic
1150968901 17:70004269-70004291 GGCAGTGCTGCATTCTTTTCTGG + Intergenic
1151158422 17:72143894-72143916 GGGAACTCTGCATCCTTTCCAGG - Intergenic
1152814761 17:82400951-82400973 GGCGAATCTGCTGTCTGTGCCGG + Intronic
1155263244 18:24065559-24065581 GGAAAATCTTCAGTCTTTCCAGG - Intronic
1155513355 18:26599565-26599587 GTCAAAGCTGGATTCTTTGTGGG - Intronic
1156021639 18:32606287-32606309 GGCAAATCCTCATGCTGTGCTGG - Intergenic
1157087722 18:44598759-44598781 GGCAAATCTGCACATTTTACAGG + Intergenic
1158898389 18:61937334-61937356 GGCAAATCTTCATCCTTTGAAGG - Intergenic
1159687680 18:71443766-71443788 AGCAAATCTGCATTCCTTTCTGG + Intergenic
1160488212 18:79312578-79312600 GCCACATCTGCCTTCTTTTCAGG + Intronic
1162620250 19:11837450-11837472 GCCAAGTCTGCATTCTTTCTTGG - Intergenic
1165655856 19:37531582-37531604 TGGAAAACTGCATTCTATGCAGG - Intronic
1168677390 19:58288697-58288719 GGCTAATCTGCAGGCATTGCTGG - Intronic
925178553 2:1801393-1801415 GGAAAACCTTCATTGTTTGCAGG + Intronic
925200025 2:1959642-1959664 GGCATAGCTCCATTCTCTGCAGG - Intronic
927185098 2:20476524-20476546 GTCAAATCTGTTTTATTTGCTGG + Intergenic
927710278 2:25321218-25321240 GGCAGGGCTGCATTCTTTTCTGG + Intronic
930056322 2:47254799-47254821 AGGAAATCTGCATTCCATGCTGG + Intergenic
930220217 2:48739031-48739053 GGCACATCTCCCTTCTCTGCTGG + Intronic
930453051 2:51568218-51568240 GGCAAAGCTGTATTTTTTTCTGG + Intergenic
933503126 2:83141912-83141934 TTCTAATCTGCATTCTATGCTGG - Intergenic
933736911 2:85502658-85502680 GTAACATCTGCATTCTTTTCTGG + Intergenic
934306945 2:91833667-91833689 AGCAAATCTCAATTCTATGCTGG + Intergenic
934326311 2:92019075-92019097 AGCAAATCTCAATTCTATGCTGG - Intergenic
934464664 2:94249690-94249712 AGCAAATCTTAATTCTATGCTGG - Intergenic
938722166 2:134076599-134076621 GGCATCTCTGCATTCTTGGGGGG - Intergenic
939688999 2:145234621-145234643 GGCAAATTTGCTGTCTTTGCTGG + Intergenic
941444581 2:165584677-165584699 TGCAACTCTGAATTTTTTGCAGG - Intronic
941551913 2:166927407-166927429 GGCAAGTCTGCATTTTTTTCTGG + Intronic
945929285 2:215839357-215839379 GGCAAATCCTCATTATCTGCAGG + Intergenic
948092426 2:235305696-235305718 GGGACTTCTGCATTCTCTGCTGG + Intergenic
1169642088 20:7763972-7763994 GGCAACTTTGCATGCTTTGGTGG - Intergenic
1170120843 20:12910122-12910144 GGCCAGGCTGCATTCTTTTCTGG + Intergenic
1172065703 20:32218687-32218709 GGCAAATCTCCATCCTTTGAGGG - Intronic
1172886645 20:38235648-38235670 TGCAGAGCTGCATTCTTTCCTGG - Intronic
1173598110 20:44272934-44272956 GGCAAACATGCAGTCTATGCGGG + Intronic
1173626172 20:44474623-44474645 GGCAAGGCTGCATTCTTTTGGGG - Intergenic
1176313120 21:5165169-5165191 GGCAAATCTGCATTCTTTGCTGG - Intergenic
1176896535 21:14384907-14384929 AGCAAAGCTGCATTCCTTTCTGG + Intergenic
1178237695 21:30861918-30861940 GGCAAGGCTACATTCTTTCCAGG - Intergenic
1179843928 21:44096861-44096883 GGCAAATCTGCATTCTTTGCTGG + Intronic
1180278569 22:10669977-10669999 AGCAAATCTCAATTCTATGCTGG - Intergenic
1180585822 22:16888841-16888863 AGCAAATCTCAATTCTATGCTGG - Intergenic
949134617 3:549010-549032 AGCAAATTTGCAATTTTTGCGGG - Intergenic
951458437 3:22920383-22920405 GGCAAAGCTTTATCCTTTGCAGG - Intergenic
951994072 3:28707472-28707494 AGCAAGGCTGCATTCTTTTCTGG + Intergenic
952053215 3:29411775-29411797 GGAAAAGATCCATTCTTTGCTGG - Intronic
953664672 3:44917369-44917391 GGCAGCTCTGCAGTCTTTCCAGG + Intronic
955766764 3:62352734-62352756 GGCATATCTGCCTTCTATGGAGG + Intergenic
955875912 3:63490233-63490255 AGCAAAACTGGTTTCTTTGCTGG - Intronic
957619850 3:82581537-82581559 GGTAAGTCTGCACCCTTTGCAGG - Intergenic
959162382 3:102737788-102737810 GGCAAAGCTGCATTCATTGATGG + Intergenic
960666264 3:120111930-120111952 GGCACATCTGGATTCATTCCAGG + Intergenic
962484836 3:135832273-135832295 GGCTAATCTGAATGCTTTCCAGG + Intergenic
964169390 3:153751640-153751662 GGGAAATCTGTATTCTTTCTAGG - Intergenic
964202290 3:154131359-154131381 GGCAAATCTGAATACTTTCTTGG - Intronic
965535320 3:169817917-169817939 GGCAAATCTTGATGCTGTGCTGG - Intergenic
966345614 3:178976344-178976366 AGCAAAAATGCATTCATTGCTGG + Intergenic
968024416 3:195427242-195427264 GGCAGGGCTGCATTCTTTTCTGG - Intronic
969114913 4:4865448-4865470 GGCAAATCTGGGTTCTTTTCTGG + Intergenic
969171440 4:5367117-5367139 GGGAAATGTGAATTCTTTCCAGG - Intronic
970543445 4:17102348-17102370 GGCAAAGCAGCATTCTGTGCAGG - Intergenic
971795326 4:31219586-31219608 GGCAGGGCTGCATTCTTTTCTGG + Intergenic
972914797 4:43862276-43862298 GGGAAATGAACATTCTTTGCTGG - Intergenic
974365836 4:60947573-60947595 GGCAAAGCTGCATTCTCATCTGG + Intergenic
977382861 4:96298834-96298856 AGCAAAGCTGCATTCTTTTCTGG - Intergenic
977452250 4:97213544-97213566 GGAAAATCTGAAATCATTGCTGG - Intronic
978754193 4:112285561-112285583 GACAAAGCTGCTGTCTTTGCGGG + Intronic
980498422 4:133615556-133615578 GGCAAATTTGATCTCTTTGCTGG + Intergenic
981417704 4:144512428-144512450 GGGACATCTGCCATCTTTGCTGG + Intergenic
983182208 4:164661616-164661638 TGCAAATCTGCATTTATTGCTGG + Intergenic
984225488 4:177029923-177029945 GGCAACTCAGCATTCTTTAAAGG - Intergenic
985321765 4:188720781-188720803 GACAATTCTGCATTCATAGCAGG + Intergenic
985763638 5:1765000-1765022 GGCATGTCTGGATTCTCTGCAGG + Intergenic
986424363 5:7615319-7615341 GGCACTTCTGAATTCCTTGCTGG + Intronic
988183440 5:27828551-27828573 GGCAAAGCTGCATTCCTTGCTGG - Intergenic
988505114 5:31815367-31815389 GGAAAATCTACATTCTATACAGG - Intronic
990055383 5:51570441-51570463 CCCATATCTGCAATCTTTGCAGG - Intergenic
990612010 5:57467134-57467156 GGCAGATCTGCAATCAGTGCAGG - Intergenic
990997268 5:61745336-61745358 GGCATATCTGCAGTTTGTGCAGG + Intronic
992010593 5:72522558-72522580 GCCAAATCAAAATTCTTTGCAGG - Intergenic
993593128 5:89820919-89820941 GGGAAATTTACATTCTTGGCAGG + Intergenic
993822402 5:92634859-92634881 GGCAAATGTGCATCCTTGTCAGG + Intergenic
995689284 5:114805414-114805436 GGCATATTTGTCTTCTTTGCAGG + Intergenic
998070630 5:139195268-139195290 GGCAAATCTTCATTCTTTGAGGG + Intronic
998618800 5:143771798-143771820 GGCAGCTCAGCATTCTCTGCAGG - Intergenic
1000205387 5:159053029-159053051 GGCAAATTTCCATCCTTTGCTGG - Intronic
1000251023 5:159495726-159495748 GGCGAATCCTCATTCTTTGGGGG + Intergenic
1000639622 5:163686178-163686200 GGAAAATGTGCATTATCTGCTGG - Intergenic
1002054327 5:176590056-176590078 GTGACATCTGCCTTCTTTGCAGG + Exonic
1003766973 6:9248761-9248783 GGCAAGTCTTCATTCTATGATGG - Intergenic
1004748746 6:18539217-18539239 GGCAAATCATCATCCTTTGGGGG + Intergenic
1008416709 6:51249207-51249229 AGCAAAGCTGCATTCCTTTCAGG + Intergenic
1008640731 6:53459840-53459862 GGCAAATTATCCTTCTTTGCAGG + Intergenic
1008881553 6:56385354-56385376 GGCAGAGCTGCATTCCTTTCTGG + Intronic
1009416252 6:63419501-63419523 TGTATATCTGCATTCTTAGCTGG + Intergenic
1010845004 6:80695523-80695545 AGCCAATCTGTATTCTTTACAGG + Intergenic
1011146975 6:84228230-84228252 TTCAAAACTGCATTCTTTACTGG + Intergenic
1013163995 6:107573369-107573391 CACAAATCTGCTTTCTTTTCTGG - Intronic
1014837341 6:126174304-126174326 GACACATCTACAGTCTTTGCTGG + Intergenic
1017956571 6:159183220-159183242 GGCATATTTGCTTTCTTTGAGGG + Intronic
1018040470 6:159917152-159917174 GGCAAATCTTCCTTGTTTCCTGG + Intergenic
1020836905 7:13164850-13164872 GTGAAATCTTCATTCTTTGAGGG - Intergenic
1020921832 7:14274900-14274922 GTCAAATATGCATTTTTTGGGGG + Intronic
1024135471 7:46403100-46403122 GGCAAATCTGCAGGCCGTGCTGG - Intergenic
1027632665 7:80626211-80626233 GGCAAATCTCCATATTTTGCTGG + Intronic
1028527643 7:91803030-91803052 GGCACAGCTGCATTCCTTTCTGG + Intronic
1030548402 7:110927684-110927706 AGCAAAGCTGCATTCTTTTCTGG - Intronic
1034186905 7:149185140-149185162 GGAATATCTGCCTTCTTTGATGG - Intergenic
1034856791 7:154557373-154557395 GTAAAAGTTGCATTCTTTGCTGG + Intronic
1041317153 8:56575735-56575757 GAGAAATCTTCATTCATTGCTGG - Intergenic
1042556830 8:70040743-70040765 TGAAAAGCTGCATTCTTTTCAGG - Intergenic
1042715516 8:71768447-71768469 AAAAAATCTGCATTCTTTGGAGG + Intergenic
1044224486 8:89703907-89703929 GGCAAAACTGCAGACTTTCCCGG + Intergenic
1044462757 8:92465144-92465166 GGCAAATCTTCATTCATGACTGG + Intergenic
1044796188 8:95900539-95900561 GACAGAGCTGCATTCTTTTCTGG + Intergenic
1046198480 8:110892525-110892547 GGCAAAGCTGCATTTATTGACGG - Intergenic
1048672565 8:136739410-136739432 GGGAAATCTGCTTCCTTTGGTGG - Intergenic
1049974918 9:852341-852363 GGCAAATTTACATTTTTTTCCGG + Intronic
1050652490 9:7789441-7789463 GGCAAAGCTGCATTTATTGACGG - Intergenic
1052150569 9:25109782-25109804 GGAAAATCTGCCTTTTTTTCAGG + Intergenic
1052278229 9:26702874-26702896 GGAAAAGCTGCTTTCTTTTCTGG + Intergenic
1052584005 9:30401185-30401207 GTCAAGTCTGTATTCTTTGTTGG + Intergenic
1053694754 9:40626454-40626476 AGCAAATCTCAATTCTATGCTGG - Intergenic
1053941738 9:43256830-43256852 AGCAAATCTCAATTCTATGCTGG - Intergenic
1054270087 9:63013662-63013684 AGCAAATCTCAATTCTATGCTGG + Intergenic
1054305998 9:63425678-63425700 AGCAAATCTCAATTCTATGCTGG - Intergenic
1054404740 9:64749660-64749682 AGCAAATCTCAATTCTATGCTGG - Intergenic
1054438364 9:65235152-65235174 AGCAAATCTCAATTCTATGCTGG - Intergenic
1054492040 9:65786796-65786818 AGCAAATCTCAATTCTATGCTGG + Intergenic
1054730765 9:68700883-68700905 GTGAAATCTGCATTCTTTCTTGG - Intergenic
1055009839 9:71553166-71553188 GGCAAAGCTCCATGCTGTGCAGG - Intergenic
1055062282 9:72082263-72082285 GGCAGAACTGACTTCTTTGCGGG + Intergenic
1056732713 9:89179682-89179704 GGAAAATATGCCTTCTTTTCAGG + Intergenic
1062558650 9:137129352-137129374 GGCAAATCTGCTTTCCGGGCCGG - Intergenic
1062575332 9:137204317-137204339 CACAAAACTGCAGTCTTTGCTGG + Exonic
1202777199 9_KI270717v1_random:58-80 AGCAAATCTCAATTCTATGCTGG - Intergenic
1186927512 X:14351514-14351536 TGCAAATCAGCATTCTATGTGGG + Intergenic
1187147946 X:16654983-16655005 GGCATTTCTGGATTCTTTTCAGG - Intronic
1187909695 X:24100031-24100053 GACAAGGCTGCATTCTTTTCTGG + Intergenic
1188480414 X:30631202-30631224 GGCAAGGCTGCATTCCTTTCTGG - Intergenic
1190029676 X:46959849-46959871 GACAGAGCTGCATGCTTTGCAGG + Intronic
1193021575 X:76798473-76798495 GGAAAAGCTGCATTCATTGATGG + Intergenic
1194129242 X:90059707-90059729 GGCAGAGTTGCATTCTTTTCTGG - Intergenic
1194581980 X:95684595-95684617 GGCAGAGCTGCATTCCTTTCTGG - Intergenic
1195433459 X:104815314-104815336 GGCAGGGCTGCATTCTTTTCTGG + Intronic
1198080761 X:133237038-133237060 GGCAAATCTTGTTTCTTTGGGGG - Intergenic
1198273960 X:135083621-135083643 GGCAAATCTGCTCTCTTTTCAGG + Intergenic
1198517246 X:137421862-137421884 GGAAAATCGTCATGCTTTGCAGG + Intergenic
1198953973 X:142106576-142106598 AGAAACTCTGCATTATTTGCAGG + Intergenic
1200500941 Y:3948292-3948314 GGCAAAACTGTATTCTTGGAAGG + Intergenic
1201192558 Y:11458402-11458424 AGCAAATCTCAATTCTATGCTGG - Intergenic