ID: 1176313910

View in Genome Browser
Species Human (GRCh38)
Location 21:5223896-5223918
Sequence CTCTGCAAATAAAATAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176313910_1176313911 1 Left 1176313910 21:5223896-5223918 CCAACTTTATTTTATTTGCAGAG No data
Right 1176313911 21:5223920-5223942 TAAAATTTAAATAGACATTCAGG No data
1176313910_1176313912 13 Left 1176313910 21:5223896-5223918 CCAACTTTATTTTATTTGCAGAG No data
Right 1176313912 21:5223932-5223954 AGACATTCAGGAAACAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176313910 Original CRISPR CTCTGCAAATAAAATAAAGT TGG (reversed) Intergenic
No off target data available for this crispr