ID: 1176316136

View in Genome Browser
Species Human (GRCh38)
Location 21:5246267-5246289
Sequence GCCCCACGGGACCTGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176316136_1176316143 23 Left 1176316136 21:5246267-5246289 CCTTCACTCAGGTCCCGTGGGGC No data
Right 1176316143 21:5246313-5246335 CTTCTTTCTTTGAATGTTCATGG No data
1176316136_1176316140 -1 Left 1176316136 21:5246267-5246289 CCTTCACTCAGGTCCCGTGGGGC No data
Right 1176316140 21:5246289-5246311 CCTGCCCTCTAAAGTCTCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176316136 Original CRISPR GCCCCACGGGACCTGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr