ID: 1176326904

View in Genome Browser
Species Human (GRCh38)
Location 21:5509201-5509223
Sequence AAGTAGACACAAATCCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176326898_1176326904 26 Left 1176326898 21:5509152-5509174 CCACCTCGGCACAGTCACCTGTA No data
Right 1176326904 21:5509201-5509223 AAGTAGACACAAATCCCCATGGG No data
1176326899_1176326904 23 Left 1176326899 21:5509155-5509177 CCTCGGCACAGTCACCTGTAGTG No data
Right 1176326904 21:5509201-5509223 AAGTAGACACAAATCCCCATGGG No data
1176326897_1176326904 27 Left 1176326897 21:5509151-5509173 CCCACCTCGGCACAGTCACCTGT No data
Right 1176326904 21:5509201-5509223 AAGTAGACACAAATCCCCATGGG No data
1176326900_1176326904 9 Left 1176326900 21:5509169-5509191 CCTGTAGTGTACTGAGATGAGCA No data
Right 1176326904 21:5509201-5509223 AAGTAGACACAAATCCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176326904 Original CRISPR AAGTAGACACAAATCCCCAT GGG Intergenic
No off target data available for this crispr