ID: 1176327320

View in Genome Browser
Species Human (GRCh38)
Location 21:5511613-5511635
Sequence CAGAGGAAAAAGGAGCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176327320_1176327333 24 Left 1176327320 21:5511613-5511635 CCTCCATGCTCCTTTTTCCTCTG No data
Right 1176327333 21:5511660-5511682 CGCAACTCTCAGGTCACCATTGG No data
1176327320_1176327329 14 Left 1176327320 21:5511613-5511635 CCTCCATGCTCCTTTTTCCTCTG No data
Right 1176327329 21:5511650-5511672 CAATGCCTCCCGCAACTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176327320 Original CRISPR CAGAGGAAAAAGGAGCATGG AGG (reversed) Intergenic
No off target data available for this crispr