ID: 1176327331

View in Genome Browser
Species Human (GRCh38)
Location 21:5511658-5511680
Sequence AATGGTGACCTGAGAGTTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176327331_1176327336 3 Left 1176327331 21:5511658-5511680 CCCGCAACTCTCAGGTCACCATT No data
Right 1176327336 21:5511684-5511706 GAAGATGCTCAGGAAGAACAAGG No data
1176327331_1176327334 -7 Left 1176327331 21:5511658-5511680 CCCGCAACTCTCAGGTCACCATT No data
Right 1176327334 21:5511674-5511696 CACCATTGGAGAAGATGCTCAGG No data
1176327331_1176327337 27 Left 1176327331 21:5511658-5511680 CCCGCAACTCTCAGGTCACCATT No data
Right 1176327337 21:5511708-5511730 GCTGCAGTCAACCCTGCTGAAGG No data
1176327331_1176327338 30 Left 1176327331 21:5511658-5511680 CCCGCAACTCTCAGGTCACCATT No data
Right 1176327338 21:5511711-5511733 GCAGTCAACCCTGCTGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176327331 Original CRISPR AATGGTGACCTGAGAGTTGC GGG (reversed) Intergenic
No off target data available for this crispr