ID: 1176330801

View in Genome Browser
Species Human (GRCh38)
Location 21:5547010-5547032
Sequence AAGTAGACACAAATCCCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176330801_1176330808 27 Left 1176330801 21:5547010-5547032 CCCATGGGGATTTGTGTCTACTT No data
Right 1176330808 21:5547060-5547082 ACAGGTGACTGTGCCGAGGTGGG No data
1176330801_1176330807 26 Left 1176330801 21:5547010-5547032 CCCATGGGGATTTGTGTCTACTT No data
Right 1176330807 21:5547059-5547081 TACAGGTGACTGTGCCGAGGTGG No data
1176330801_1176330806 23 Left 1176330801 21:5547010-5547032 CCCATGGGGATTTGTGTCTACTT No data
Right 1176330806 21:5547056-5547078 CACTACAGGTGACTGTGCCGAGG No data
1176330801_1176330805 9 Left 1176330801 21:5547010-5547032 CCCATGGGGATTTGTGTCTACTT No data
Right 1176330805 21:5547042-5547064 TGCTCATCTCAGTACACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176330801 Original CRISPR AAGTAGACACAAATCCCCAT GGG (reversed) Intergenic
No off target data available for this crispr