ID: 1176331148

View in Genome Browser
Species Human (GRCh38)
Location 21:5549381-5549403
Sequence ATGTGAAAAGAGCTGGTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176331148_1176331151 -3 Left 1176331148 21:5549381-5549403 CCGGGAACCAGCTCTTTTCACAT No data
Right 1176331151 21:5549401-5549423 CATCATTTGAGGTAAGACGATGG No data
1176331148_1176331156 30 Left 1176331148 21:5549381-5549403 CCGGGAACCAGCTCTTTTCACAT No data
Right 1176331156 21:5549434-5549456 TCCAGAAGTCACACTGCGCTGGG No data
1176331148_1176331154 0 Left 1176331148 21:5549381-5549403 CCGGGAACCAGCTCTTTTCACAT No data
Right 1176331154 21:5549404-5549426 CATTTGAGGTAAGACGATGGGGG No data
1176331148_1176331152 -2 Left 1176331148 21:5549381-5549403 CCGGGAACCAGCTCTTTTCACAT No data
Right 1176331152 21:5549402-5549424 ATCATTTGAGGTAAGACGATGGG No data
1176331148_1176331155 29 Left 1176331148 21:5549381-5549403 CCGGGAACCAGCTCTTTTCACAT No data
Right 1176331155 21:5549433-5549455 CTCCAGAAGTCACACTGCGCTGG No data
1176331148_1176331153 -1 Left 1176331148 21:5549381-5549403 CCGGGAACCAGCTCTTTTCACAT No data
Right 1176331153 21:5549403-5549425 TCATTTGAGGTAAGACGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176331148 Original CRISPR ATGTGAAAAGAGCTGGTTCC CGG (reversed) Intergenic
No off target data available for this crispr