ID: 1176331665

View in Genome Browser
Species Human (GRCh38)
Location 21:5553964-5553986
Sequence GGTCCTCGATGCTGGCCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176331665_1176331677 15 Left 1176331665 21:5553964-5553986 CCGCTGGGCCAGCATCGAGGACC No data
Right 1176331677 21:5554002-5554024 GCCCATCCGGTGCTGTCCCTGGG No data
1176331665_1176331673 2 Left 1176331665 21:5553964-5553986 CCGCTGGGCCAGCATCGAGGACC No data
Right 1176331673 21:5553989-5554011 CACATCCGGCCTGGCCCATCCGG No data
1176331665_1176331668 -7 Left 1176331665 21:5553964-5553986 CCGCTGGGCCAGCATCGAGGACC No data
Right 1176331668 21:5553980-5554002 GAGGACCCCCACATCCGGCCTGG No data
1176331665_1176331676 14 Left 1176331665 21:5553964-5553986 CCGCTGGGCCAGCATCGAGGACC No data
Right 1176331676 21:5554001-5554023 GGCCCATCCGGTGCTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176331665 Original CRISPR GGTCCTCGATGCTGGCCCAG CGG (reversed) Intergenic